After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rhesus PNLIP Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus PNLIP cDNA Clone Product Information
NCBI RefSeq:XM_001095070.2
RefSeq ORF Size:1398bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) pancreatic lipase with N terminal Flag tag.
Gene Synonym:PNLIP
Species:Rhesus
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

PNLIP is an enzyme which belongs to the lipase family. Secreted from the pancreas, PNLIP is the primary lipase that hydrolyzes dietary fat molecules in the human digestive system, converting triglyceride substrates found in ingested oils to monoglycerides and free fatty acids. Bile salts secreted from the liver and stored in gallbladder are released into the duodenum where they coat and emulsify large fat droplets into smaller droplets, thus increasing the overall surface area of the fat, which allows the lipase to break apart the fat more effectively. The resulting monomers (2 free fatty acids and one 2-monoacylglycerol) are then moved by way of peristalsis along the small intestine to be absorbed into the lymphatic system by a specialized vessel called a lacteal.

References
  • Hegele RA, et al. (2001) Polymorphisms in PNLIP, encoding pancreatic lipase, and associations with metabolic traits. J Hum Genet. 46(6):320-4.
  • Thomas A, et al. (2005) Role of the lid hydrophobicity pattern in pancreatic lipase activity. J Biol Chem. 280(48):40074-83.
  • Colin DY, et al. (2008) Exploring the active site cavity of human pancreatic lipase. Biochem Biophys Res Commun. 370(3):394-8.
  • Size / Price
    Catalog: CG90537-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"