PHB/Prohibitin cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag

Cat: CG90553-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PHB/Prohibitin Reagents
CRO Services
Product recommended

All PHB/Prohibitin Reagents
PHB/Prohibitin cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
819 bp
Description
Full length Clone DNA of Rhesus prohibitin with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PHB/Prohibitin Background Information
Full Name
prohibitin

PHB/Prohibitin cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
PHB/Prohibitin cDNA ORF Clone in Cloning Vector, Rhesus CG90553-G
PHB/Prohibitin cDNA ORF Clone, Rhesus, untagged CG90553-UT
PHB/Prohibitin Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90553-ACGLN
PHB/Prohibitin cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90553-ACG
PHB/Prohibitin cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90553-ANG
PHB/Prohibitin cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90553-ACR
PHB/Prohibitin cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90553-ANR
PHB/Prohibitin cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90553-CF
PHB/Prohibitin cDNA ORF Clone, Rhesus, C-His tag CG90553-CH
PHB/Prohibitin cDNA ORF Clone, Rhesus, N-His tag CG90553-NH
PHB/Prohibitin cDNA ORF Clone, Rhesus, C-HA tag CG90553-CY
PHB/Prohibitin cDNA ORF Clone, Rhesus, N-HA tag CG90553-NY
PHB/Prohibitin cDNA ORF Clone, Rhesus, C-Myc tag CG90553-CM
PHB/Prohibitin cDNA ORF Clone, Rhesus, N-Myc tag CG90553-NM

PHB/Prohibitin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PHB/Prohibitin cDNA ORF Clone in Cloning Vector, Rat RG81472-G

PHB/Prohibitin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PHB/Prohibitin cDNA ORF Clone in Cloning Vector, Mouse MG53000-G
PHB/Prohibitin cDNA ORF Clone, Mouse, untagged MG53000-UT
PHB/Prohibitin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53000-ACGLN
PHB/Prohibitin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53000-ACG
PHB/Prohibitin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53000-ANG
PHB/Prohibitin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53000-ACR
PHB/Prohibitin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53000-ANR
PHB/Prohibitin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53000-CF
PHB/Prohibitin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53000-NF
PHB/Prohibitin cDNA ORF Clone, Mouse, C-His tag MG53000-CH
PHB/Prohibitin cDNA ORF Clone, Mouse, N-His tag MG53000-NH
PHB/Prohibitin cDNA ORF Clone, Mouse, C-HA tag MG53000-CY
PHB/Prohibitin cDNA ORF Clone, Mouse, N-HA tag MG53000-NY
PHB/Prohibitin cDNA ORF Clone, Mouse, C-Myc tag MG53000-CM
PHB/Prohibitin cDNA ORF Clone, Mouse, N-Myc tag MG53000-NM

PHB/Prohibitin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PHB/Prohibitin cDNA ORF Clone in Cloning Vector, Human HG12035-G
PHB/Prohibitin cDNA ORF Clone, Human, untagged HG12035-UT
PHB/Prohibitin cDNA ORF Clone, Human, C-GFPSpark® tag HG12035-ACG
PHB/Prohibitin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12035-ACGLN
PHB/Prohibitin cDNA ORF Clone, Human, N-GFPSpark® tag HG12035-ANG
PHB/Prohibitin cDNA ORF Clone, Human, C-OFPSpark® tag HG12035-ACR
PHB/Prohibitin cDNA ORF Clone, Human, N-OFPSpark® tag HG12035-ANR
PHB/Prohibitin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12035-CF
PHB/Prohibitin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12035-NF
PHB/Prohibitin cDNA ORF Clone, Human, C-His tag HG12035-CH
PHB/Prohibitin cDNA ORF Clone, Human, N-His tag HG12035-NH
PHB/Prohibitin cDNA ORF Clone, Human, C-HA tag HG12035-CY
PHB/Prohibitin cDNA ORF Clone, Human, N-HA tag HG12035-NY
PHB/Prohibitin cDNA ORF Clone, Human, C-Myc tag HG12035-CM
PHB/Prohibitin cDNA ORF Clone, Human, N-Myc tag HG12035-NM
PHB/Prohibitin qPCR Primer Pairs, Human HP101569
info info
添加购物车成功! 添加购物车失败!