Profilin-2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag

Cat: CG90562-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Profilin-2 Reagents
CRO Services
Product recommended

All Profilin-2 Reagents
Profilin-2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
423 bp
Description
Full length Clone DNA of Cynomolgus Profilin-2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Profilin-2 Background Information

Profilin 2, also known as PFN2, is a ubiquitous actin monomer-binding protein belonging to the profilin family. It is highly expressed in brain, skeletal muscle and kidney and less strongly in heart, placenta, lung and liver. Profilin 2 binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations. Profilin 2 is thought to regulate actin polymerization in response to extracellular signals. It inhibits the formation of IP3 and DG by binding to PIP2.

Full Name
profilin 2
References
  • Da Silva. et al., 2003, J Cell Biol. 162 (7): 1267-79.
  • Honore B. et al., 1993, FEBS Lett. 330 (2): 151-5.
  • Joensuu T. et al., 1997, Genomics. 38 (3): 255-63.
  • Profilin-2 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Profilin-2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90562-G
    Profilin-2 cDNA ORF Clone, Cynomolgus, untagged CG90562-UT
    Profilin-2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90562-ACGLN
    Profilin-2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90562-ACG
    Profilin-2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90562-ANG
    Profilin-2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90562-ACR
    Profilin-2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90562-ANR
    Profilin-2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90562-CF
    Profilin-2 cDNA ORF Clone, Cynomolgus, C-His tag CG90562-CH
    Profilin-2 cDNA ORF Clone, Cynomolgus, N-His tag CG90562-NH
    Profilin-2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90562-CY
    Profilin-2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90562-NY
    Profilin-2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90562-CM
    Profilin-2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90562-NM

    Profilin-2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Profilin-2 cDNA ORF Clone in Cloning Vector, Rat RG84237-U
    Profilin-2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84237-ACGLN

    Profilin-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Profilin-2 cDNA ORF Clone in Cloning Vector, Mouse MG51608-U
    Profilin-2 cDNA ORF Clone, Mouse, untagged MG51608-UT
    Profilin-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51608-ACGLN
    Profilin-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51608-ACG
    Profilin-2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51608-ANG
    Profilin-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51608-ACR
    Profilin-2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51608-ANR
    Profilin-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51608-CF
    Profilin-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51608-NF
    Profilin-2 cDNA ORF Clone, Mouse, C-His tag MG51608-CH
    Profilin-2 cDNA ORF Clone, Mouse, N-His tag MG51608-NH
    Profilin-2 cDNA ORF Clone, Mouse, C-HA tag MG51608-CY
    Profilin-2 cDNA ORF Clone, Mouse, N-HA tag MG51608-NY
    Profilin-2 cDNA ORF Clone, Mouse, C-Myc tag MG51608-CM
    Profilin-2 cDNA ORF Clone, Mouse, N-Myc tag MG51608-NM
    Profilin-2 qPCR Primer Pairs, Mouse MP201275

    Profilin-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Profilin-2 cDNA ORF Clone in Cloning Vector, Human HG14496-G
    Profilin-2 cDNA ORF Clone, Human, untagged HG14496-UT
    Profilin-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14496-ACG
    Profilin-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14496-ACGLN
    Profilin-2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14496-ANG
    Profilin-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14496-ACR
    Profilin-2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14496-ANR
    Profilin-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14496-CF
    Profilin-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14496-NF
    Profilin-2 cDNA ORF Clone, Human, C-His tag HG14496-CH
    Profilin-2 cDNA ORF Clone, Human, N-His tag HG14496-NH
    Profilin-2 cDNA ORF Clone, Human, C-HA tag HG14496-CY
    Profilin-2 cDNA ORF Clone, Human, N-HA tag HG14496-NY
    Profilin-2 cDNA ORF Clone, Human, C-Myc tag HG14496-CM
    Profilin-2 cDNA ORF Clone, Human, N-Myc tag HG14496-NM
    Profilin-2 qPCR Primer Pairs, Human HP103143
    info info
    添加购物车成功! 添加购物车失败!