PEX16 cDNA ORF Clone, Cynomolgus, C-HA tag

Cat: CG90472-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PEX16 Reagents
CRO Services
Product recommended

All PEX16 Reagents
PEX16 cDNA ORF Clone, Cynomolgus, C-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1011 bp
Description
Full length Clone DNA of Cynomolgus peroxisomal biogenesis factor 16 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PEX16 Background Information
Full Name
peroxisomal biogenesis factor 16

PEX16 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
PEX16 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90472-G
PEX16 cDNA ORF Clone, Cynomolgus, untagged CG90472-UT
PEX16 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90472-ACG
PEX16 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90472-ACGLN
PEX16 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90472-ANG
PEX16 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90472-ACR
PEX16 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90472-ANR
PEX16 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90472-CF
PEX16 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90472-NF
PEX16 cDNA ORF Clone, Cynomolgus, C-His tag CG90472-CH
PEX16 cDNA ORF Clone, Cynomolgus, N-His tag CG90472-NH
PEX16 cDNA ORF Clone, Cynomolgus, N-HA tag CG90472-NY
PEX16 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90472-CM
PEX16 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90472-NM

PEX16 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PEX16 cDNA ORF Clone in Cloning Vector, Rat RG89232-U
PEX16 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89232-ACGLN

PEX16 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PEX16 cDNA ORF Clone in Cloning Vector, Human HG14729-G
PEX16 cDNA ORF Clone, Human, untagged HG14729-UT
PEX16 cDNA ORF Clone, Human, C-GFPSpark® tag HG14729-ACG
PEX16 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14729-ACGLN
PEX16 cDNA ORF Clone, Human, C-OFPSpark® tag HG14729-ACR
PEX16 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14729-CF
PEX16 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14729-NF
PEX16 cDNA ORF Clone, Human, C-His tag HG14729-CH
PEX16 cDNA ORF Clone, Human, N-His tag HG14729-NH
PEX16 cDNA ORF Clone, Human, C-HA tag HG14729-CY
PEX16 cDNA ORF Clone, Human, N-HA tag HG14729-NY
PEX16 cDNA ORF Clone, Human, C-Myc tag HG14729-CM
PEX16 cDNA ORF Clone, Human, N-Myc tag HG14729-NM
PEX16 qPCR Primer Pairs, Human HP103362
info info
添加购物车成功! 添加购物车失败!