PCBP4/MCG10 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90763-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PCBP4/MCG10 Reagents
CRO Services
Product recommended

All PCBP4/MCG10 Reagents
PCBP4/MCG10 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1212 bp
Description
Full length Clone DNA of Rhesus poly(rC) binding protein 4 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PCBP4/MCG10 Background Information
Full Name
poly(rC) binding protein 4

PCBP4/MCG10 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
PCBP4/MCG10 cDNA ORF Clone in Cloning Vector, Rhesus CG90763-G
PCBP4/MCG10 cDNA ORF Clone, Rhesus, untagged CG90763-UT
PCBP4/MCG10 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90763-ACGLN
PCBP4/MCG10 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90763-ACG
PCBP4/MCG10 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90763-ANG
PCBP4/MCG10 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90763-ACR
PCBP4/MCG10 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90763-ANR
PCBP4/MCG10 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90763-CF
PCBP4/MCG10 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90763-NF
PCBP4/MCG10 cDNA ORF Clone, Rhesus, C-His tag CG90763-CH
PCBP4/MCG10 cDNA ORF Clone, Rhesus, N-His tag CG90763-NH
PCBP4/MCG10 cDNA ORF Clone, Rhesus, C-HA tag CG90763-CY
PCBP4/MCG10 cDNA ORF Clone, Rhesus, N-HA tag CG90763-NY
PCBP4/MCG10 cDNA ORF Clone, Rhesus, C-Myc tag CG90763-CM

PCBP4/MCG10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PCBP4/MCG10 cDNA ORF Clone in Cloning Vector, Mouse MG52954-G
PCBP4/MCG10 cDNA ORF Clone, Mouse, untagged MG52954-UT
PCBP4/MCG10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52954-ACGLN
PCBP4/MCG10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52954-ACG
PCBP4/MCG10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52954-ANG
PCBP4/MCG10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52954-ACR
PCBP4/MCG10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52954-ANR
PCBP4/MCG10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52954-CF
PCBP4/MCG10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52954-NF
PCBP4/MCG10 cDNA ORF Clone, Mouse, C-His tag MG52954-CH
PCBP4/MCG10 cDNA ORF Clone, Mouse, N-His tag MG52954-NH
PCBP4/MCG10 cDNA ORF Clone, Mouse, C-HA tag MG52954-CY
PCBP4/MCG10 cDNA ORF Clone, Mouse, N-HA tag MG52954-NY
PCBP4/MCG10 cDNA ORF Clone, Mouse, C-Myc tag MG52954-CM
PCBP4/MCG10 cDNA ORF Clone, Mouse, N-Myc tag MG52954-NM
info info
添加购物车成功! 添加购物车失败!