Quick Order

Text Size:AAA

Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus PARN cDNA Clone Product Information
NCBI RefSeq:XM_005591297.1
RefSeq ORF Size:1920bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) poly(A)-specific ribonuclease with C terminal His tag.
Gene Synonym:PARN
Species:Cynomolgus
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, C-GFPSpark tagCG90462-ACG$245
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, C-OFPSpark tagCG90462-ACR$245
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, N-GFPSpark tagCG90462-ANG$245
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, N-OFPSpark tagCG90462-ANR$245
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, C-Flag tagCG90462-CF$215
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, C-His tagCG90462-CH$215
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, C-Myc tagCG90462-CM$215
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, C-HA tagCG90462-CY$215
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone in cloning vectorCG90462-G$75
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, N-Flag tagCG90462-NF$215
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, N-His tagCG90462-NH$215
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, N-Myc tagCG90462-NM$215
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmid, N-HA tagCG90462-NY$215
Cynomolgus PARN/poly(A)-specific ribonuclease Gene ORF cDNA clone expression plasmidCG90462-UT$215
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: CG90462-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"