Quick Order

Cynomolgus OTUB1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Cynomolgus OTUB1 cDNA Clone Product Information
    NCBI RefSeq:unsubmitted
    RefSeq ORF Size:816bp
    cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) OTU domain, ubiquitin aldehyde binding 1 with C terminal His tag.
    Gene Synonym:OTUB1
    Species:Cynomolgus
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    Ubiquitin thioesterase OTUB1, also known as Deubiquitinating enzyme OTUB1, OTU domain-containing ubiquitin aldehyde-binding protein 1, Otubain-1, Ubiquitin-specific-processing protease OTUB1, OTUB1 and OTB1, is a cytoplasm protein which belongs to the peptidase C65 family. OTUB1 is a hydrolase that can remove conjugated ubiquitin from proteins and plays an important regulatory role at the level of protein turnover by preventing degradation. OTUB1 is a regulator of T-cell anergy, a phenomenon that occurs when T-cells are rendered unresponsive to antigen rechallenge and no longer respond to their cognate antigen. OTUB1 acts via its interaction with RNF128 / GRAIL, a crucial inductor of CD4 T-cell anergy. Isoform 1 of OTUB1 destabilizes RNF128, leading to prevent anergy. In contrast, isoform 2 of OTUB1 stabilizes RNF128 and promotes anergy. OTUB1 regulates RNF128-mediated ubiquitination, but does not deubiquitinate polyubiquitinated RNF128. Deubiquitinates estrogen receptor alpha (ESR1). OTUB1 mediates deubiquitination of 'Lys-48'-linked polyubiquitin chains, but not 'Lys-63'-linked polyubiquitin chains. OTUB1 is also capable of removing NEDD8 from NEDD8 conjugates, but with a much lower preference compared to 'Lys-48'-linked ubiquitin.

    References
  • Balakirev M.Y., et al., 2003, EMBO Rep. 4:517-522.
  • Soares L., et al., 2004, Nat. Immunol. 5:45-54.
  • Stanisic V., et al., 2009, J. Biol. Chem. 284:16135-16145.
  • Choudhary C., et al., 2009, Science 325:834-840.
  • Edelmann M.J., et al., 2009, Biochem. J. 418:379-390.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"