Quick Order

Text Size:AAA

Rhesus OMGP Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus OMG cDNA Clone Product Information
NCBI RefSeq:NM_001260823.1
RefSeq ORF Size:1323bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) oligodendrocyte myelin glycoprotein with N terminal Myc tag.
Gene Synonym:OMG
Species:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Mouse oligodendrocyte-myelin glycoprotein, also known as OMG and OMGP, is a cell membrane protein which contains eight LRR (leucine-rich) repeats. OMG / OMGP is a glycosylphosphatidylinositol-anchored protein expressed by neurons and oligodendrocytes in the central nervous system (CNS). OMG / OMGP is a cell adhesion molecule contributing to the interactive process required for myelination in the central nervous system. OMG / OMGP play roles in both the developing and adult central nervous system. OMG / OMGP participats in growth cone collapse and inhibition of neurite outgrowth through its interaction with NgR, the receptor for Nogo. This function requires its leucine-rich repeat domain, a highly conserved region in OMgp during mammal evolution. OMG / OMGP leucine-rich repeat domain is also implicated in the inhibition of cell proliferation. OMG / OMGP may also be involved in the formation and maintenance of myelin sheaths. Cell proliferation, neuronal sprouting and myelination are crucial processes involved in brain development and regeneration after injury.

Size / Price
Catalog: CG90713-NM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"