LOX-1 cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90155-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LOX-1 Reagents
CRO Services
Product recommended

All LOX-1 Reagents
LOX-1 cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
822 bp
Description
Full length Clone DNA of Rhesus oxidized low density lipoprotein (lectin-like) receptor 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LOX-1 Background Information

Oxidized low-density lipoprotein receptor 1 (Ox-LDL receptor 1 or OLR1), also known as lectin-type oxidized LDL receptor 1 (LOX1), is a receptor protein that belongs to the C-type lectin superfamily. LOX1 is a multi-ligand receptor originally identified as the endothelial oxidized LDL receptor. OLR1 / LOX1 was isolated from an aortic endothelial cell, and recently it has been discovered in macrophages and vascular smooth muscle cells in artery vessels. The expression of LOX1 is inducted by inflammatory stimuli and oxidative stimuli. This protein binds, internalizes and degrades oxidized low-density lipoprotein. LOX1 may play an important role in the progression of vulnerable carotid plaque and might regulate vulnerable plaque formation in cooperation with MMPs and TIMP-2. In clinical, LOX1 is thought to be involved in the development of atherosclerotic lesions. 

Full Name
oxidized low density lipoprotein (lectin-like) receptor 1
References
  • Hinagata J, et al. (2006) Oxidized LDL receptor LOX-1 is involved in neointimal hyperplasia after balloon arterial injury in a rat model. Cardiovasc Res. 69 (1): 263-71.
  • Melan MA, et al. (1994) The LOX1 Gene of Arabidopsis Is Temporally and Spatially Regulated in Germinating Seedlings. Plant Physiol. 105 (1): 385-93.
  • Saito A, et al. (2010) Relationship between lectin-like oxidized low-density lipoprotein receptor 1 expression and preoperative echogenic findings of vulnerable carotid plaque. Acta Neurochir (Wien). 152 (4): 589-95.
  • LOX-1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    LOX-1 cDNA ORF Clone in Cloning Vector, Rhesus CG90155-G
    LOX-1 cDNA ORF Clone, Rhesus, untagged CG90155-UT
    LOX-1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90155-ACGLN
    LOX-1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90155-ACG
    LOX-1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90155-ACR
    LOX-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90155-CF
    LOX-1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90155-NF
    LOX-1 cDNA ORF Clone, Rhesus, C-His tag CG90155-CH
    LOX-1 cDNA ORF Clone, Rhesus, N-His tag CG90155-NH
    LOX-1 cDNA ORF Clone, Rhesus, C-HA tag CG90155-CY
    LOX-1 cDNA ORF Clone, Rhesus, N-HA tag CG90155-NY
    LOX-1 cDNA ORF Clone, Rhesus, N-Myc tag CG90155-NM

    LOX-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LOX-1 cDNA ORF Clone in Cloning Vector, Rat RG80268-G
    LOX-1 cDNA ORF Clone, Rat, untagged RG80268-UT
    LOX-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80268-ACGLN
    LOX-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80268-ACG
    LOX-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80268-ACR
    LOX-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80268-CF
    LOX-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80268-NF
    LOX-1 cDNA ORF Clone, Rat, C-His tag RG80268-CH
    LOX-1 cDNA ORF Clone, Rat, N-His tag RG80268-NH
    LOX-1 cDNA ORF Clone, Rat, C-HA tag RG80268-CY
    LOX-1 cDNA ORF Clone, Rat, N-HA tag RG80268-NY
    LOX-1 cDNA ORF Clone, Rat, C-Myc tag RG80268-CM
    LOX-1 cDNA ORF Clone, Rat, N-Myc tag RG80268-NM
    LOX-1 qPCR Primer Pairs, Rat RP300252

    LOX-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LOX-1 cDNA ORF Clone in Cloning Vector, Human HG10585-M
    LOX-1 cDNA ORF Clone, Human, untagged HG10585-UT
    LOX-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10585-ACG
    LOX-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10585-ACGLN
    LOX-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10585-ACR
    LOX-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10585-CF
    LOX-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10585-NF
    LOX-1 cDNA ORF Clone, Human, C-His tag HG10585-CH
    LOX-1 cDNA ORF Clone, Human, N-His tag HG10585-NH
    LOX-1 cDNA ORF Clone, Human, C-HA tag HG10585-CY
    LOX-1 cDNA ORF Clone, Human, N-HA tag HG10585-NY
    LOX-1 cDNA ORF Clone, Human, C-Myc tag HG10585-CM
    LOX-1 cDNA ORF Clone, Human, N-Myc tag HG10585-NM
    LOX-1 qPCR Primer Pairs, Human HP100588
    info info
    添加购物车成功! 添加购物车失败!