NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90477-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NSF/N-ethylmaleimide-sensitive factor Reagents
CRO Services
Product recommended

All NSF/N-ethylmaleimide-sensitive factor Reagents
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, C-HA tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1953 bp
Description
Full length Clone DNA of Rhesus N-ethylmaleimide-sensitive factor with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NSF/N-ethylmaleimide-sensitive factor Background Information
Full Name
N-ethylmaleimide-sensitive factor

NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone in Cloning Vector, Rhesus CG90477-G
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, untagged CG90477-UT
NSF/N-ethylmaleimide-sensitive factor Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90477-ACGLN
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90477-ACG
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90477-ANG
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90477-ACR
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90477-ANR
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90477-CF
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90477-NF
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, C-His tag CG90477-CH
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, N-His tag CG90477-NH
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, N-HA tag CG90477-NY
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, C-Myc tag CG90477-CM
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Rhesus, N-Myc tag CG90477-NM

NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone in Cloning Vector, Mouse MG52445-G
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, untagged MG52445-UT
NSF/N-ethylmaleimide-sensitive factor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52445-ACGLN
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52445-ACG
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52445-ANG
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52445-ACR
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52445-ANR
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52445-CF
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52445-NF
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, C-His tag MG52445-CH
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, N-His tag MG52445-NH
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, C-HA tag MG52445-CY
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, N-HA tag MG52445-NY
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, C-Myc tag MG52445-CM
NSF/N-ethylmaleimide-sensitive factor cDNA ORF Clone, Mouse, N-Myc tag MG52445-NM
NSF/N-ethylmaleimide-sensitive factor qPCR Primer Pairs, Mouse MP202318
info info
添加购物车成功! 添加购物车失败!