Quick Order

Rhesus NEU1/Neuraminidase1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Cynomolgus NEU1 cDNA Clone Product Information
NCBI RefSeq:NM_001266298.1
RefSeq ORF Size:1251bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) sialidase 1 (lysosomal sialidase).
Gene Synonym:NEU1
Species:Rhesus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: CG90764-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"