NEFL/Neurofilament cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90623-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NEFL/Neurofilament Reagents
CRO Services
Product recommended

All NEFL/Neurofilament Reagents
NEFL/Neurofilament cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1632 bp
Description
Full length Clone DNA of Rhesus neurofilament, light polypeptide with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NEFL/Neurofilament Background Information
Full Name
neurofilament, light polypeptide

NEFL/Neurofilament cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
NEFL/Neurofilament cDNA ORF Clone in Cloning Vector, Rhesus CG90623-G
NEFL/Neurofilament cDNA ORF Clone, Rhesus, untagged CG90623-UT
NEFL/Neurofilament Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90623-ACGLN
NEFL/Neurofilament cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90623-ACG
NEFL/Neurofilament cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90623-ANG
NEFL/Neurofilament cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90623-ACR
NEFL/Neurofilament cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90623-ANR
NEFL/Neurofilament cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90623-CF
NEFL/Neurofilament cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90623-NF
NEFL/Neurofilament cDNA ORF Clone, Rhesus, C-His tag CG90623-CH
NEFL/Neurofilament cDNA ORF Clone, Rhesus, C-HA tag CG90623-CY
NEFL/Neurofilament cDNA ORF Clone, Rhesus, N-HA tag CG90623-NY
NEFL/Neurofilament cDNA ORF Clone, Rhesus, C-Myc tag CG90623-CM
NEFL/Neurofilament cDNA ORF Clone, Rhesus, N-Myc tag CG90623-NM

NEFL/Neurofilament cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NEFL/Neurofilament cDNA ORF Clone in Cloning Vector, Mouse MG57098-U
NEFL/Neurofilament cDNA ORF Clone, Mouse, untagged MG57098-UT
NEFL/Neurofilament Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57098-ACGLN
NEFL/Neurofilament cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57098-ACG
NEFL/Neurofilament cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57098-ANG
NEFL/Neurofilament cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57098-ACR
NEFL/Neurofilament cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57098-ANR
NEFL/Neurofilament cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57098-CF
NEFL/Neurofilament cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57098-NF
NEFL/Neurofilament cDNA ORF Clone, Mouse, C-His tag MG57098-CH
NEFL/Neurofilament cDNA ORF Clone, Mouse, N-His tag MG57098-NH
NEFL/Neurofilament cDNA ORF Clone, Mouse, C-HA tag MG57098-CY
NEFL/Neurofilament cDNA ORF Clone, Mouse, N-HA tag MG57098-NY
NEFL/Neurofilament cDNA ORF Clone, Mouse, C-Myc tag MG57098-CM
NEFL/Neurofilament cDNA ORF Clone, Mouse, N-Myc tag MG57098-NM

NEFL/Neurofilament cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NEFL/Neurofilament cDNA ORF Clone in Cloning Vector, Human HG13214-G
NEFL/Neurofilament cDNA ORF Clone, Human, untagged HG13214-UT
NEFL/Neurofilament cDNA ORF Clone, Human, C-GFPSpark® tag HG13214-ACG
NEFL/Neurofilament Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13214-ACGLN
NEFL/Neurofilament cDNA ORF Clone, Human, N-GFPSpark® tag HG13214-ANG
NEFL/Neurofilament cDNA ORF Clone, Human, C-OFPSpark® tag HG13214-ACR
NEFL/Neurofilament cDNA ORF Clone, Human, N-OFPSpark® tag HG13214-ANR
NEFL/Neurofilament cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13214-CF
NEFL/Neurofilament cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13214-NF
NEFL/Neurofilament cDNA ORF Clone, Human, C-His tag HG13214-CH
NEFL/Neurofilament cDNA ORF Clone, Human, N-His tag HG13214-NH
NEFL/Neurofilament cDNA ORF Clone, Human, C-HA tag HG13214-CY
NEFL/Neurofilament cDNA ORF Clone, Human, N-HA tag HG13214-NY
NEFL/Neurofilament cDNA ORF Clone, Human, C-Myc tag HG13214-CM
NEFL/Neurofilament cDNA ORF Clone, Human, N-Myc tag HG13214-NM
NEFL/Neurofilament qPCR Primer Pairs, Human HP101785
info info
添加购物车成功! 添加购物车失败!