NDUFA10 cDNA ORF Clone, Cynomolgus, C-His tag

Cat: CG90483-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NDUFA10 Reagents
CRO Services
Product recommended

All NDUFA10 Reagents
NDUFA10 cDNA ORF Clone, Cynomolgus, C-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1068 bp
Description
Full length Clone DNA of Cynomolgus NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDUFA10 Background Information
Full Name
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa

NDUFA10 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
NDUFA10 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90483-G
NDUFA10 cDNA ORF Clone, Cynomolgus, untagged CG90483-UT
NDUFA10 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90483-ACGLN
NDUFA10 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90483-ACG
NDUFA10 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90483-ANG
NDUFA10 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90483-ACR
NDUFA10 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90483-ANR
NDUFA10 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90483-CF
NDUFA10 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90483-NF
NDUFA10 cDNA ORF Clone, Cynomolgus, N-His tag CG90483-NH
NDUFA10 cDNA ORF Clone, Cynomolgus, C-HA tag CG90483-CY
NDUFA10 cDNA ORF Clone, Cynomolgus, N-HA tag CG90483-NY
NDUFA10 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90483-CM
NDUFA10 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90483-NM

NDUFA10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NDUFA10 cDNA ORF Clone in Cloning Vector, Rat RG85048-U
NDUFA10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85048-ACGLN

NDUFA10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDUFA10 cDNA ORF Clone in Cloning Vector, Mouse MG51661-G
NDUFA10 cDNA ORF Clone, Mouse, untagged MG51661-UT
NDUFA10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51661-ACG
NDUFA10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51661-ACGLN
NDUFA10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51661-ANG
NDUFA10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51661-ACR
NDUFA10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51661-ANR
NDUFA10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51661-CF
NDUFA10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51661-NF
NDUFA10 cDNA ORF Clone, Mouse, C-His tag MG51661-CH
NDUFA10 cDNA ORF Clone, Mouse, N-His tag MG51661-NH
NDUFA10 cDNA ORF Clone, Mouse, C-HA tag MG51661-CY
NDUFA10 cDNA ORF Clone, Mouse, N-HA tag MG51661-NY
NDUFA10 cDNA ORF Clone, Mouse, C-Myc tag MG51661-CM
NDUFA10 cDNA ORF Clone, Mouse, N-Myc tag MG51661-NM
NDUFA10 qPCR Primer Pairs, Mouse MP201534

NDUFA10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDUFA10 cDNA ORF Clone in Cloning Vector, Human HG17024-U
NDUFA10 cDNA ORF Clone, Human, untagged HG17024-UT
NDUFA10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17024-ACGLN
NDUFA10 cDNA ORF Clone, Human, C-GFPSpark® tag HG17024-ACG
NDUFA10 cDNA ORF Clone, Human, N-GFPSpark® tag HG17024-ANG
NDUFA10 cDNA ORF Clone, Human, C-OFPSpark® tag HG17024-ACR
NDUFA10 cDNA ORF Clone, Human, N-OFPSpark® tag HG17024-ANR
NDUFA10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17024-CF
NDUFA10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17024-NF
NDUFA10 cDNA ORF Clone, Human, C-His tag HG17024-CH
NDUFA10 cDNA ORF Clone, Human, N-His tag HG17024-NH
NDUFA10 cDNA ORF Clone, Human, C-HA tag HG17024-CY
NDUFA10 cDNA ORF Clone, Human, N-HA tag HG17024-NY
NDUFA10 cDNA ORF Clone, Human, C-Myc tag HG17024-CM
NDUFA10 cDNA ORF Clone, Human, N-Myc tag HG17024-NM
info info
添加购物车成功! 添加购物车失败!