NCALD cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag

Cat: CG90565-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NCALD Reagents
CRO Services
Product recommended

All NCALD Reagents
NCALD cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
582 bp
Description
Full length Clone DNA of Rhesus neurocalcin delta with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NCALD Background Information
Full Name
neurocalcin delta

NCALD cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
NCALD cDNA ORF Clone in Cloning Vector, Rhesus CG90565-G
NCALD cDNA ORF Clone, Rhesus, untagged CG90565-UT
NCALD cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90565-ACG
NCALD Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90565-ACGLN
NCALD cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90565-ANG
NCALD cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90565-ACR
NCALD cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90565-ANR
NCALD cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90565-CF
NCALD cDNA ORF Clone, Rhesus, C-His tag CG90565-CH
NCALD cDNA ORF Clone, Rhesus, N-His tag CG90565-NH
NCALD cDNA ORF Clone, Rhesus, C-HA tag CG90565-CY
NCALD cDNA ORF Clone, Rhesus, N-HA tag CG90565-NY
NCALD cDNA ORF Clone, Rhesus, C-Myc tag CG90565-CM
NCALD cDNA ORF Clone, Rhesus, N-Myc tag CG90565-NM

NCALD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NCALD cDNA ORF Clone in Cloning Vector, Mouse MG51340-U
NCALD cDNA ORF Clone, Mouse, untagged MG51340-UT
NCALD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51340-ACG
NCALD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51340-ACGLN
NCALD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51340-ANG
NCALD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51340-ACR
NCALD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51340-ANR
NCALD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51340-CF
NCALD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51340-NF
NCALD cDNA ORF Clone, Mouse, C-His tag MG51340-CH
NCALD cDNA ORF Clone, Mouse, N-His tag MG51340-NH
NCALD cDNA ORF Clone, Mouse, C-HA tag MG51340-CY
NCALD cDNA ORF Clone, Mouse, N-HA tag MG51340-NY
NCALD cDNA ORF Clone, Mouse, C-Myc tag MG51340-CM
NCALD cDNA ORF Clone, Mouse, N-Myc tag MG51340-NM
NCALD qPCR Primer Pairs, Mouse MP201217

NCALD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NCALD cDNA ORF Clone in Cloning Vector, Human HG15664-G
NCALD cDNA ORF Clone, Human, untagged HG15664-UT
NCALD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15664-ACGLN
NCALD cDNA ORF Clone, Human, C-GFPSpark® tag HG15664-ACG
NCALD cDNA ORF Clone, Human, N-GFPSpark® tag HG15664-ANG
NCALD cDNA ORF Clone, Human, C-OFPSpark® tag HG15664-ACR
NCALD cDNA ORF Clone, Human, N-OFPSpark® tag HG15664-ANR
NCALD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15664-CF
NCALD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15664-NF
NCALD cDNA ORF Clone, Human, C-His tag HG15664-CH
NCALD cDNA ORF Clone, Human, N-His tag HG15664-NH
NCALD cDNA ORF Clone, Human, C-HA tag HG15664-CY
NCALD cDNA ORF Clone, Human, N-HA tag HG15664-NY
NCALD cDNA ORF Clone, Human, C-Myc tag HG15664-CM
NCALD cDNA ORF Clone, Human, N-Myc tag HG15664-NM
NCALD qPCR Primer Pairs, Human HP104279
info info
添加购物车成功! 添加购物车失败!