CD20 cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90052-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD20 Reagents
CRO Services
Product recommended

All CD20 Reagents
CD20 cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
894 bp
Description
Full length Clone DNA of Rhesus membrane-spanning 4-domains, subfamily A, member 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD20 Background Information

CD20 (membrane-spanning 4-domains, subfamily A, member 1), also known as MS4A1, is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. CD20 / MS4A1 is expressed on all stages of B cell development except the first and last. CD20 / MS4A1 is present from pre-pre B cells through memory cells, but not on either pro-B cells or plasma cells. It is a B-lymphocyte surface molecule which plays a role in the development and differentiation of B-cells into plasma cells. CD20 / MS4A1may be involved in the regulation of B-cell activation and proliferation. Defects in CD20 / MS4A1 are the cause of immunodeficiency common variable type 5(CVID5). CVID5 is a primary immunodeficiency characterized by antibody deficiency, hypogammaglobulinemia, recurrent bacterial infections and an inability to mount an antibody response to antigen. The defect results from a failure of B-cell differentiation and impaired secretion of immunoglobulins; the numbers of circulating B-cells is usually in the normal range, but can be low.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
membrane-spanning 4-domains, subfamily A, member 1
References
  • Tedder TF, et al. (1988) Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes. Proc Natl Acad Sci. 85(1): 208-12.
  • Cragg MS, et al. (2005) The biology of CD20 and its potential as a target for mAb therapy. Curr Dir Autoimmun. 8: 140-74..
  • Polyak MJ, et al. (2003) A cholesterol-dependent CD20 epitope detected by the FMC7 antibody. Leukemia. 17(7): 1384-9.
  • CD20 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    CD20 cDNA ORF Clone in Cloning Vector, Ferret FG60004-G
    CD20 cDNA ORF Clone, Ferret, untagged FG60004-UT
    CD20 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60004-ACGLN
    CD20 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60004-ACG
    CD20 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60004-ACR
    CD20 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60004-CF
    CD20 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60004-NF
    CD20 cDNA ORF Clone, Ferret, C-His tag FG60004-CH
    CD20 cDNA ORF Clone, Ferret, N-His tag FG60004-NH
    CD20 cDNA ORF Clone, Ferret, C-HA tag FG60004-CY
    CD20 cDNA ORF Clone, Ferret, N-HA tag FG60004-NY
    CD20 cDNA ORF Clone, Ferret, C-Myc tag FG60004-CM
    CD20 cDNA ORF Clone, Ferret, N-Myc tag FG60004-NM

    CD20 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD20 cDNA ORF Clone in Cloning Vector, Rhesus CG90052-G
    CD20 cDNA ORF Clone, Rhesus, untagged CG90052-UT
    CD20 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90052-ACGLN
    CD20 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90052-ACG
    CD20 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90052-ACR
    CD20 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90052-CF
    CD20 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90052-NF
    CD20 cDNA ORF Clone, Rhesus, C-His tag CG90052-CH
    CD20 cDNA ORF Clone, Rhesus, C-HA tag CG90052-CY
    CD20 cDNA ORF Clone, Rhesus, N-HA tag CG90052-NY
    CD20 cDNA ORF Clone, Rhesus, C-Myc tag CG90052-CM
    CD20 cDNA ORF Clone, Rhesus, N-Myc tag CG90052-NM

    CD20 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD20 cDNA ORF Clone in Cloning Vector, Mouse MG50399-G
    CD20 cDNA ORF Clone, Mouse, untagged MG50399-UT
    CD20 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50399-ACG
    CD20 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50399-ACGLN
    CD20 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50399-ACR
    CD20 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50399-CF
    CD20 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50399-NF
    CD20 cDNA ORF Clone, Mouse, C-His tag MG50399-CH
    CD20 cDNA ORF Clone, Mouse, N-His tag MG50399-NH
    CD20 cDNA ORF Clone, Mouse, C-HA tag MG50399-CY
    CD20 cDNA ORF Clone, Mouse, N-HA tag MG50399-NY
    CD20 cDNA ORF Clone, Mouse, C-Myc tag MG50399-CM
    CD20 cDNA ORF Clone, Mouse, N-Myc tag MG50399-NM
    CD20 qPCR Primer Pairs, Mouse MP200417

    CD20 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD20 cDNA ORF Clone in Cloning Vector, Human HG11007-M
    CD20 cDNA ORF Clone, Human, untagged HG11007-UT
    CD20 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11007-ACGLN
    CD20 cDNA ORF Clone, Human, C-GFPSpark® tag HG11007-ACG
    CD20 cDNA ORF Clone, Human, C-OFPSpark® tag HG11007-ACR
    CD20 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11007-CF
    CD20 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11007-NF
    CD20 cDNA ORF Clone, Human, C-His tag HG11007-CH
    CD20 cDNA ORF Clone, Human, N-His tag HG11007-NH
    CD20 cDNA ORF Clone, Human, C-HA tag HG11007-CY
    CD20 cDNA ORF Clone, Human, N-HA tag HG11007-NY
    CD20 cDNA ORF Clone, Human, C-Myc tag HG11007-CM
    CD20 cDNA ORF Clone, Human, N-Myc tag HG11007-NM
    CD20 qPCR Primer Pairs, Human HP100969
    info info
    添加购物车成功! 添加购物车失败!