MRPS17 cDNA ORF Clone, Cynomolgus, N-Myc tag

Cat: CG90761-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MRPS17 Reagents
CRO Services
Product recommended

All MRPS17 Reagents
MRPS17 cDNA ORF Clone, Cynomolgus, N-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
393 bp
Description
Full length Clone DNA of Cynomolgus mitochondrial ribosomal protein S17 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPS17 Background Information
Full Name
mitochondrial ribosomal protein S17

MRPS17 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
MRPS17 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90761-G
MRPS17 cDNA ORF Clone, Cynomolgus, untagged CG90761-UT
MRPS17 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90761-ACGLN
MRPS17 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90761-ACG
MRPS17 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90761-ANG
MRPS17 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90761-ACR
MRPS17 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90761-ANR
MRPS17 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90761-CF
MRPS17 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90761-NF
MRPS17 cDNA ORF Clone, Cynomolgus, C-His tag CG90761-CH
MRPS17 cDNA ORF Clone, Cynomolgus, N-His tag CG90761-NH
MRPS17 cDNA ORF Clone, Cynomolgus, C-HA tag CG90761-CY
MRPS17 cDNA ORF Clone, Cynomolgus, N-HA tag CG90761-NY
MRPS17 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90761-CM

MRPS17 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPS17 cDNA ORF Clone in Cloning Vector, Mouse MG5A5039-U
MRPS17 cDNA ORF Clone, Mouse, untagged MG5A5039-UT
MRPS17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5039-ACG
MRPS17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5039-ACGLN
MRPS17 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5039-ANG
MRPS17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5039-ACR
MRPS17 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5039-ANR
MRPS17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5039-CF
MRPS17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5039-NF
MRPS17 cDNA ORF Clone, Mouse, C-His tag MG5A5039-CH
MRPS17 cDNA ORF Clone, Mouse, N-His tag MG5A5039-NH
MRPS17 cDNA ORF Clone, Mouse, C-HA tag MG5A5039-CY
MRPS17 cDNA ORF Clone, Mouse, N-HA tag MG5A5039-NY
MRPS17 cDNA ORF Clone, Mouse, C-Myc tag MG5A5039-CM
MRPS17 cDNA ORF Clone, Mouse, N-Myc tag MG5A5039-NM
info info
添加购物车成功! 添加购物车失败!