MLC1 cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90490-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MLC1 Reagents
CRO Services
Product recommended

All MLC1 Reagents
MLC1 cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1134 bp
Description
Full length Clone DNA of Rhesus megalencephalic leukoencephalopathy with subcortical cysts 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MLC1 Background Information
Full Name
megalencephalic leukoencephalopathy with subcortical cysts 1

MLC1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
MLC1 cDNA ORF Clone in Cloning Vector, Rhesus CG90490-G
MLC1 cDNA ORF Clone, Rhesus, untagged CG90490-UT
MLC1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90490-ACG
MLC1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90490-ACGLN
MLC1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90490-ANG
MLC1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90490-ACR
MLC1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90490-ANR
MLC1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90490-CF
MLC1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90490-NF
MLC1 cDNA ORF Clone, Rhesus, C-His tag CG90490-CH
MLC1 cDNA ORF Clone, Rhesus, N-His tag CG90490-NH
MLC1 cDNA ORF Clone, Rhesus, C-HA tag CG90490-CY
MLC1 cDNA ORF Clone, Rhesus, N-HA tag CG90490-NY
MLC1 cDNA ORF Clone, Rhesus, N-Myc tag CG90490-NM

MLC1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
MLC1 cDNA ORF Clone in Cloning Vector, Rabbit TG65049-G
MLC1 cDNA ORF Clone, Rabbit, untagged TG65049-UT
MLC1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65049-ACG
MLC1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65049-ANG
MLC1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65049-ACR
MLC1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65049-ANR
MLC1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65049-CF
MLC1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65049-NF
MLC1 cDNA ORF Clone, Rabbit, C-His tag TG65049-CH
MLC1 cDNA ORF Clone, Rabbit, N-His tag TG65049-NH
MLC1 cDNA ORF Clone, Rabbit, C-HA tag TG65049-CY
MLC1 cDNA ORF Clone, Rabbit, N-HA tag TG65049-NY
MLC1 cDNA ORF Clone, Rabbit, C-Myc tag TG65049-CM
MLC1 cDNA ORF Clone, Rabbit, N-Myc tag TG65049-NM

MLC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MLC1 cDNA ORF Clone in Cloning Vector, Mouse MG52618-G
MLC1 cDNA ORF Clone, Mouse, untagged MG52618-UT
MLC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52618-ACG
MLC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52618-ACGLN
MLC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52618-ACR
MLC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52618-CF
MLC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52618-NF
MLC1 cDNA ORF Clone, Mouse, C-His tag MG52618-CH
MLC1 cDNA ORF Clone, Mouse, N-His tag MG52618-NH
MLC1 cDNA ORF Clone, Mouse, C-HA tag MG52618-CY
MLC1 cDNA ORF Clone, Mouse, N-HA tag MG52618-NY
MLC1 cDNA ORF Clone, Mouse, C-Myc tag MG52618-CM
MLC1 cDNA ORF Clone, Mouse, N-Myc tag MG52618-NM
MLC1 qPCR Primer Pairs, Mouse MP202489

MLC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MLC1 cDNA ORF Clone, Human, untagged HG18381-UT
info info
添加购物车成功! 添加购物车失败!