MIOX cDNA ORF Clone, Cynomolgus, N-HA tag

Cat: CG90501-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MIOX Reagents
CRO Services
Product recommended

All MIOX Reagents
MIOX cDNA ORF Clone, Cynomolgus, N-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
858 bp
Description
Full length Clone DNA of Cynomolgus myo-inositol oxygenase with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MIOX Background Information
Full Name
myo-inositol oxygenase

MIOX cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
MIOX cDNA ORF Clone in Cloning Vector, Cynomolgus CG90501-U
MIOX cDNA ORF Clone, Cynomolgus, untagged CG90501-UT
MIOX Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90501-ACGLN
MIOX cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90501-ACG
MIOX cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90501-ANG
MIOX cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90501-ACR
MIOX cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90501-ANR
MIOX cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90501-CF
MIOX cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90501-NF
MIOX cDNA ORF Clone, Cynomolgus, C-His tag CG90501-CH
MIOX cDNA ORF Clone, Cynomolgus, N-His tag CG90501-NH
MIOX cDNA ORF Clone, Cynomolgus, C-HA tag CG90501-CY
MIOX cDNA ORF Clone, Cynomolgus, C-Myc tag CG90501-CM
MIOX cDNA ORF Clone, Cynomolgus, N-Myc tag CG90501-NM

MIOX cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MIOX cDNA ORF Clone in Cloning Vector, Human HG13828-G
MIOX cDNA ORF Clone, Human, untagged HG13828-UT
MIOX cDNA ORF Clone, Human, C-GFPSpark® tag HG13828-ACG
MIOX Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13828-ACGLN
MIOX cDNA ORF Clone, Human, N-GFPSpark® tag HG13828-ANG
MIOX cDNA ORF Clone, Human, C-OFPSpark® tag HG13828-ACR
MIOX cDNA ORF Clone, Human, N-OFPSpark® tag HG13828-ANR
MIOX cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13828-CF
MIOX cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13828-NF
MIOX cDNA ORF Clone, Human, C-His tag HG13828-CH
MIOX cDNA ORF Clone, Human, N-His tag HG13828-NH
MIOX cDNA ORF Clone, Human, C-HA tag HG13828-CY
MIOX cDNA ORF Clone, Human, N-HA tag HG13828-NY
MIOX cDNA ORF Clone, Human, C-Myc tag HG13828-CM
MIOX cDNA ORF Clone, Human, N-Myc tag HG13828-NM
MIOX qPCR Primer Pairs, Human HP102500
info info
添加购物车成功! 添加购物车失败!