MGST3 cDNA ORF Clone, Cynomolgus, C-HA tag

Cat: CG90513-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MGST3 Reagents
CRO Services
Product recommended

All MGST3 Reagents
MGST3 cDNA ORF Clone, Cynomolgus, C-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Cynomolgus microsomal glutathione S-transferase 3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MGST3 Background Information
Full Name
microsomal glutathione S-transferase 3

MGST3 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
MGST3 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90513-U
MGST3 cDNA ORF Clone, Cynomolgus, untagged CG90513-UT
MGST3 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90513-ACG
MGST3 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90513-ACGLN
MGST3 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90513-ANG
MGST3 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90513-ACR
MGST3 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90513-ANR
MGST3 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90513-CF
MGST3 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90513-NF
MGST3 cDNA ORF Clone, Cynomolgus, C-His tag CG90513-CH
MGST3 cDNA ORF Clone, Cynomolgus, N-His tag CG90513-NH
MGST3 cDNA ORF Clone, Cynomolgus, N-HA tag CG90513-NY
MGST3 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90513-CM
MGST3 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90513-NM

MGST3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MGST3 cDNA ORF Clone in Cloning Vector, Rat RG80711-U
MGST3 cDNA ORF Clone, Rat, untagged RG80711-UT
MGST3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80711-ACGLN
MGST3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80711-ACG
MGST3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80711-ACR
MGST3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80711-CF
MGST3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80711-NF
MGST3 cDNA ORF Clone, Rat, C-His tag RG80711-CH
MGST3 cDNA ORF Clone, Rat, N-His tag RG80711-NH
MGST3 cDNA ORF Clone, Rat, C-HA tag RG80711-CY
MGST3 cDNA ORF Clone, Rat, N-HA tag RG80711-NY
MGST3 cDNA ORF Clone, Rat, C-Myc tag RG80711-CM
MGST3 cDNA ORF Clone, Rat, N-Myc tag RG80711-NM
MGST3 qPCR Primer Pairs, Rat RP300675

MGST3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MGST3 cDNA ORF Clone in Cloning Vector, Mouse MG53281-U
MGST3 cDNA ORF Clone, Mouse, untagged MG53281-UT
MGST3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53281-ACGLN
MGST3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53281-ACG
MGST3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53281-ANG
MGST3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53281-ACR
MGST3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53281-ANR
MGST3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53281-CF
MGST3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53281-NF
MGST3 cDNA ORF Clone, Mouse, C-His tag MG53281-CH
MGST3 cDNA ORF Clone, Mouse, N-His tag MG53281-NH
MGST3 cDNA ORF Clone, Mouse, C-HA tag MG53281-CY
MGST3 cDNA ORF Clone, Mouse, N-HA tag MG53281-NY
MGST3 cDNA ORF Clone, Mouse, C-Myc tag MG53281-CM
MGST3 cDNA ORF Clone, Mouse, N-Myc tag MG53281-NM

MGST3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MGST3 cDNA ORF Clone, Human, untagged HG22233-UT
info info
添加购物车成功! 添加购物车失败!