c-MET cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag

Price:
Size:
Number:

c-MET cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
4146 bp
Description
Full length Clone DNA of Rhesus met proto-oncogene (hepatocyte growth factor receptor) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

c-MET Background Information

Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET), is a receptor tyrosine kinase (RTK) that has been shown to be overexpressed and/or mutated in a variety of malignancies. HGFR protein is produced as a single-chain precursor, and HGF is the only known ligand. Normal HGF/HGFR signaling is essential for embryonic development, tissue repair or wound healing, whereas aberrantly active HGFR has been strongly implicated in tumorigenesis, particularly in the development of invasive and metastatic phenotypes. HGFR protein is a multifaceted regulator of growth, motility, and invasion, and is normally expressed by cells of epithelial origin. Preclinical studies suggest that targeting aberrant HGFR signaling could be an attractive therapy in cancer.
Full Name
MET proto-oncogene, receptor tyrosine kinase
References
  • McGill GG, et al. (2006) c-Met expression is regulated by Mitf in the melanocyte lineage. J Biol Chem. 281(15): 10365-73.
  • Garcia S, et al. (2007) c-Met overexpression in inflammatory breast carcinomas: automated quantification on tissue microarrays. British journal of cancer. 96(2): 329-35.
  • Socoteanu MP, et al. (2008) c-Met targeted therapy of cholangiocarcinoma. World J Gastroenterol. 14(19): 2990-4.
  • Kong DS, et al. (2009) Prognostic significance of c-Met expression in glioblastomas. Cancer. 115(1): 140-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait