MDH2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag

Cat: CG90560-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MDH2 Reagents
CRO Services
Product recommended

All MDH2 Reagents
MDH2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1017 bp
Description
Full length Clone DNA of Cynomolgus Malate dehydrogenase, mitochondrial with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MDH2 Background Information
Full Name
malate dehydrogenase 2, NAD (mitochondrial)

MDH2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
MDH2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90560-G
MDH2 cDNA ORF Clone, Cynomolgus, untagged CG90560-UT
MDH2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90560-ACGLN
MDH2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90560-ACG
MDH2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90560-ANG
MDH2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90560-ACR
MDH2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90560-ANR
MDH2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90560-CF
MDH2 cDNA ORF Clone, Cynomolgus, C-His tag CG90560-CH
MDH2 cDNA ORF Clone, Cynomolgus, N-His tag CG90560-NH
MDH2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90560-CY
MDH2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90560-NY
MDH2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90560-CM
MDH2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90560-NM

MDH2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MDH2 cDNA ORF Clone in Cloning Vector, Rat RG81007-G
MDH2 cDNA ORF Clone, Rat, untagged RG81007-UT
MDH2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81007-ACGLN
MDH2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81007-ACG
MDH2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81007-ANG
MDH2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81007-ACR
MDH2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81007-ANR
MDH2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81007-CF
MDH2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81007-NF
MDH2 cDNA ORF Clone, Rat, C-His tag RG81007-CH
MDH2 cDNA ORF Clone, Rat, N-His tag RG81007-NH
MDH2 cDNA ORF Clone, Rat, C-HA tag RG81007-CY
MDH2 cDNA ORF Clone, Rat, N-HA tag RG81007-NY
MDH2 cDNA ORF Clone, Rat, C-Myc tag RG81007-CM
MDH2 cDNA ORF Clone, Rat, N-Myc tag RG81007-NM
MDH2 qPCR Primer Pairs, Rat RP300971

MDH2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MDH2 cDNA ORF Clone in Cloning Vector, Mouse MG51925-G
MDH2 cDNA ORF Clone, Mouse, untagged MG51925-UT
MDH2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51925-ACGLN
MDH2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51925-ACG
MDH2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51925-ANG
MDH2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51925-ACR
MDH2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51925-ANR
MDH2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51925-CF
MDH2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51925-NF
MDH2 cDNA ORF Clone, Mouse, C-His tag MG51925-CH
MDH2 cDNA ORF Clone, Mouse, N-His tag MG51925-NH
MDH2 cDNA ORF Clone, Mouse, C-HA tag MG51925-CY
MDH2 cDNA ORF Clone, Mouse, N-HA tag MG51925-NY
MDH2 cDNA ORF Clone, Mouse, C-Myc tag MG51925-CM
MDH2 cDNA ORF Clone, Mouse, N-Myc tag MG51925-NM
MDH2 qPCR Primer Pairs, Mouse MP201798

MDH2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MDH2 cDNA ORF Clone in Cloning Vector, Human HG16426-U
MDH2 cDNA ORF Clone, Human, untagged HG16426-UT
MDH2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16426-ACG
MDH2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16426-ACGLN
MDH2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16426-ANG
MDH2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16426-ACR
MDH2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16426-ANR
MDH2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16426-CF
MDH2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16426-NF
MDH2 cDNA ORF Clone, Human, C-His tag HG16426-CH
MDH2 cDNA ORF Clone, Human, N-His tag HG16426-NH
MDH2 cDNA ORF Clone, Human, C-HA tag HG16426-CY
MDH2 cDNA ORF Clone, Human, N-HA tag HG16426-NY
MDH2 cDNA ORF Clone, Human, C-Myc tag HG16426-CM
MDH2 cDNA ORF Clone, Human, N-Myc tag HG16426-NM
MDH2 qPCR Primer Pairs, Human HP105175
info info
添加购物车成功! 添加购物车失败!