After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Cynomolgus LOC701810 cDNA Clone Product Information
NCBI RefSeq:XM_001096089.1
RefSeq ORF Size:687bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) BTB/POZ domain-containing protein KCTD6-like.
Gene Synonym:LOC701810
Species:Rhesus
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid on other vectors
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-GFPSpark tagCG90744-ACG$225
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-OFPSpark tagCG90744-ACR$225
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-GFPSpark tagCG90744-ANG$225
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-OFPSpark tagCG90744-ANR$225
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-Flag tagCG90744-CF$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-His tagCG90744-CH$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-Myc tagCG90744-CM$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-HA tagCG90744-CY$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone in cloning vectorCG90744-G$75
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-Flag tagCG90744-NF$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-His tagCG90744-NH$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-Myc tagCG90744-NM$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-HA tagCG90744-NY$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmidCG90744-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: CG90744-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"