Quick Order

Text Size:AAA

Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Cynomolgus LOC701810 cDNA Clone Product Information
    NCBI RefSeq:XM_001096089.1
    RefSeq ORF Size:687bp
    cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) BTB/POZ domain-containing protein KCTD6-like.
    Gene Synonym:LOC701810
    Species:Rhesus
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid on other vectors
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-GFPSpark tagCG90744-ACG$325
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-OFPSpark tagCG90744-ACR$325
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-GFPSpark tagCG90744-ANG$325
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-OFPSpark tagCG90744-ANR$325
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-Flag tagCG90744-CF$295
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-His tagCG90744-CH$295
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-Myc tagCG90744-CM$295
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-HA tagCG90744-CY$295
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone in cloning vectorCG90744-G$75
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-Flag tagCG90744-NF$295
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-His tagCG90744-NH$295
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-Myc tagCG90744-NM$295
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-HA tagCG90744-NY$295
    Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmidCG90744-UT$295
     Learn more about expression Vectors
    Product nameProduct name
    Size / Price
    Catalog: CG90744-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"