Text Size:AAA

Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Cynomolgus LOC102130101 cDNA Clone Product Information
    NCBI RefSeq:NM_001284821.1
    RefSeq ORF Size:306bp
    cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) small ubiquitin-related modifier 1-like.
    Gene Synonym:LOC102130101
    Species:Cynomolgus
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid on other vectors
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-GFPSpark tagCG90733-ACG$325
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-OFPSpark tagCG90733-ACR$325
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-GFPSpark tagCG90733-ANG$325
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-OFPSpark tagCG90733-ANR$325
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-Flag tagCG90733-CF$295
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-His tagCG90733-CH$295
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-Myc tagCG90733-CM$295
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-HA tagCG90733-CY$295
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone in cloning vectorCG90733-G$75
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-Flag tagCG90733-NF$295
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-His tagCG90733-NH$295
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-Myc tagCG90733-NM$295
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-HA tagCG90733-NY$295
    Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmidCG90733-UT$295
     Learn more about expression Vectors
    Product nameProduct name
    Size / Price
    Catalog: CG90733-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"