Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90736-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Kv beta 1/KCNAB1 Reagents
CRO Services
Product recommended

All Kv beta 1/KCNAB1 Reagents
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1206 bp
Description
Full length Clone DNA of Rhesus potassium voltage-gated channel, shaker-related subfamily, beta member 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Kv beta 1/KCNAB1 Background Information
Full Name
potassium channel, voltage gated subfamily A regulatory beta subunit 1

Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Kv beta 1/KCNAB1 cDNA ORF Clone in Cloning Vector, Rhesus CG90736-G
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, untagged CG90736-UT
Kv beta 1/KCNAB1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90736-ACGLN
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90736-ACG
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90736-ANG
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90736-ACR
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90736-ANR
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90736-CF
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90736-NF
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, C-His tag CG90736-CH
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, N-His tag CG90736-NH
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, C-HA tag CG90736-CY
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, N-HA tag CG90736-NY
Kv beta 1/KCNAB1 cDNA ORF Clone, Rhesus, C-Myc tag CG90736-CM

Kv beta 1/KCNAB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Kv beta 1/KCNAB1 cDNA ORF Clone in Cloning Vector, Human HG15131-G
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, untagged HG15131-UT
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15131-ACG
Kv beta 1/KCNAB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15131-ACGLN
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15131-ANG
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15131-ACR
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15131-ANR
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15131-CF
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15131-NF
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, C-His tag HG15131-CH
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, N-His tag HG15131-NH
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, C-HA tag HG15131-CY
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, N-HA tag HG15131-NY
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, C-Myc tag HG15131-CM
Kv beta 1/KCNAB1 cDNA ORF Clone, Human, N-Myc tag HG15131-NM
Kv beta 1/KCNAB1 qPCR Primer Pairs, Human HP103758
info info
添加购物车成功! 添加购物车失败!