ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Cat: CG90212-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ITGA1/Integrin alpha 1 Reagents
CRO Services
Product recommended

All ITGA1/Integrin alpha 1 Reagents
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
3540 bp
Description
Full length Clone DNA of Rhesus integrin, alpha 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ITGA1/Integrin alpha 1 Background Information
Full Name
integrin, alpha 1

ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ITGA1/Integrin alpha 1 cDNA ORF Clone in Cloning Vector, Rhesus CG90212-G
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, untagged CG90212-UT
ITGA1/Integrin alpha 1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90212-ACGLN
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90212-ACG
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90212-ACR
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90212-NF
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, C-His tag CG90212-CH
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, N-His tag CG90212-NH
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, C-HA tag CG90212-CY
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, N-HA tag CG90212-NY
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, C-Myc tag CG90212-CM
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rhesus, N-Myc tag CG90212-NM

ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ITGA1/Integrin alpha 1 cDNA ORF Clone in Cloning Vector, Rat RG80295-G
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, untagged RG80295-UT
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80295-ACG
ITGA1/Integrin alpha 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80295-ACGLN
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80295-ACR
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80295-CF
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80295-NF
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, C-His tag RG80295-CH
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, N-His tag RG80295-NH
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, C-HA tag RG80295-CY
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, N-HA tag RG80295-NY
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, C-Myc tag RG80295-CM
ITGA1/Integrin alpha 1 cDNA ORF Clone, Rat, N-Myc tag RG80295-NM
ITGA1/Integrin alpha 1 qPCR Primer Pairs, Rat RP300271

ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ITGA1/Integrin alpha 1 cDNA ORF Clone in Cloning Vector, Mouse MG50381-M
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, untagged MG50381-UT
ITGA1/Integrin alpha 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50381-ACGLN
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50381-ACG
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50381-ACR
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50381-CF
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50381-NF
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, C-His tag MG50381-CH
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, N-His tag MG50381-NH
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, C-HA tag MG50381-CY
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, N-HA tag MG50381-NY
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, C-Myc tag MG50381-CM
ITGA1/Integrin alpha 1 cDNA ORF Clone, Mouse, N-Myc tag MG50381-NM
ITGA1/Integrin alpha 1 qPCR Primer Pairs, Mouse MP200401

ITGA1/Integrin alpha 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ITGA1/Integrin alpha 1 cDNA ORF Clone, Human, untagged HG13434-UT
ITGA1/Integrin alpha 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13434-ACGLN
ITGA1/Integrin alpha 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13434-CF
ITGA1/Integrin alpha 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13434-NF
ITGA1/Integrin alpha 1 cDNA ORF Clone, Human, C-His tag HG13434-CH
ITGA1/Integrin alpha 1 cDNA ORF Clone, Human, N-His tag HG13434-NH
ITGA1/Integrin alpha 1 cDNA ORF Clone, Human, C-HA tag HG13434-CY
ITGA1/Integrin alpha 1 cDNA ORF Clone, Human, N-HA tag HG13434-NY
ITGA1/Integrin alpha 1 cDNA ORF Clone, Human, C-Myc tag HG13434-CM
ITGA1/Integrin alpha 1 cDNA ORF Clone, Human, N-Myc tag HG13434-NM
ITGA1/Integrin alpha 1 qPCR Primer Pairs, Human HP102136
info info
添加购物车成功! 添加购物车失败!