IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, untagged

Cat: CG90782-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IRF2/IRF-2 Reagents
CRO Services
Product recommended

All IRF2/IRF-2 Reagents
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, untagged General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Description
Full length Clone DNA of Cynomolgus interferon regulatory factor 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IRF2/IRF-2 Background Information
Full Name
interferon regulatory factor 2

IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
IRF2/IRF-2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90782-G
IRF2/IRF-2 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90782-ACGLN
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90782-ACG
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90782-ANG
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90782-ACR
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90782-ANR
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90782-CF
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90782-NF
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, C-His tag CG90782-CH
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, N-His tag CG90782-NH
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, C-HA tag CG90782-CY
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, N-HA tag CG90782-NY
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90782-CM
IRF2/IRF-2 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90782-NM

IRF2/IRF-2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IRF2/IRF-2 cDNA ORF Clone in Cloning Vector, Human HG12680-U
IRF2/IRF-2 cDNA ORF Clone, Human, untagged HG12680-UT
IRF2/IRF-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12680-ACG
IRF2/IRF-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12680-ACGLN
IRF2/IRF-2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12680-ANG
IRF2/IRF-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12680-ACR
IRF2/IRF-2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12680-ANR
IRF2/IRF-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12680-CF
IRF2/IRF-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12680-NF
IRF2/IRF-2 cDNA ORF Clone, Human, C-His tag HG12680-CH
IRF2/IRF-2 cDNA ORF Clone, Human, N-His tag HG12680-NH
IRF2/IRF-2 cDNA ORF Clone, Human, C-HA tag HG12680-CY
IRF2/IRF-2 cDNA ORF Clone, Human, N-HA tag HG12680-NY
IRF2/IRF-2 cDNA ORF Clone, Human, C-Myc tag HG12680-CM
IRF2/IRF-2 cDNA ORF Clone, Human, N-Myc tag HG12680-NM
info info
添加购物车成功! 添加购物车失败!