ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, N-Myc tag

Cat: CG90786-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ILK / Integrin Linked Kinase Reagents
CRO Services
Product recommended

All ILK / Integrin Linked Kinase Reagents
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, N-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1359 bp
Description
Full length Clone DNA of Cynomolgus integrin-linked kinase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ILK / Integrin Linked Kinase Background Information
Full Name
integrin-linked kinase

ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
ILK / Integrin Linked Kinase cDNA ORF Clone in Cloning Vector, Cynomolgus CG90786-G
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, untagged CG90786-UT
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90786-ACG
ILK / Integrin Linked Kinase Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90786-ACGLN
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90786-ANG
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90786-ACR
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90786-ANR
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90786-CF
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90786-NF
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, C-His tag CG90786-CH
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, N-His tag CG90786-NH
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, C-HA tag CG90786-CY
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, N-HA tag CG90786-NY
ILK / Integrin Linked Kinase cDNA ORF Clone, Cynomolgus, C-Myc tag CG90786-CM

ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ILK / Integrin Linked Kinase cDNA ORF Clone in Cloning Vector, Mouse MG50890-G
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, untagged MG50890-UT
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50890-ACG
ILK / Integrin Linked Kinase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50890-ACGLN
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50890-ACR
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50890-CF
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50890-NF
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, C-His tag MG50890-CH
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, N-His tag MG50890-NH
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, C-HA tag MG50890-CY
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, N-HA tag MG50890-NY
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, C-Myc tag MG50890-CM
ILK / Integrin Linked Kinase cDNA ORF Clone, Mouse, N-Myc tag MG50890-NM
ILK / Integrin Linked Kinase qPCR Primer Pairs, Mouse MP200861

ILK / Integrin Linked Kinase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ILK / Integrin Linked Kinase cDNA ORF Clone in Cloning Vector, Human HG10736-M
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, untagged HG10736-UT
ILK / Integrin Linked Kinase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10736-ACGLN
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, C-GFPSpark® tag HG10736-ACG
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, N-GFPSpark® tag HG10736-ANG
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, C-OFPSpark® tag HG10736-ACR
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, N-OFPSpark® tag HG10736-ANR
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10736-CF
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10736-NF
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, C-His tag HG10736-CH
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, N-His tag HG10736-NH
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, C-HA tag HG10736-CY
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, N-HA tag HG10736-NY
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, C-Myc tag HG10736-CM
ILK / Integrin Linked Kinase cDNA ORF Clone, Human, N-Myc tag HG10736-NM
ILK / Integrin Linked Kinase qPCR Primer Pairs, Human HP100672
info info
添加购物车成功! 添加购物车失败!