After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rhesus IL7 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus IL7 cDNA Clone Product Information
NCBI RefSeq:NM_001032846.1
RefSeq ORF Size:534bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interleukin 7 with C terminal Myc tag.
Gene Synonym:IL7
Species:Rhesus
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

IL7, also known as interleukin 7, is a hematopoietic growth factor which belongs to the IL-7/IL-9 family. It is secreted by stromal cells in the bone marrow and thymus. IL7 stimulates the proliferation of lymphoid progenitors. It is important for proliferation during certain stages of B-cell maturation. IL7 and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. It is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRß) during early T cell development. IL7 can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes.

References
  • Watanabe M, et al. (1995) Interleukin 7 is produced by human intestinal epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes.
  • J Clin Invest. 95(6):2945-53. Sawa Y, et al. (2009) Hepatic interleukin-7 expression regulates T cell responses. Immunity. 30 (3):447-57.
  • Flad HD, et al. (1996) Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction. Eur J Immunol. 26(10): 2541-4.
  • Size / Price
    Catalog: CG90128-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"