Quick Order

Rhesus WSX-1/IL-27R Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus IL27RA cDNA Clone Product Information
NCBI RefSeq:XM_001111176.2
RefSeq ORF Size:1911bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interleukin 27 receptor, alpha with N terminal Myc tag.
Gene Synonym:IL27RA
Species:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

The interleukin-27 receptor is a type I cytokine receptor for interleukin-27. It is a heterodimer composed of the interleukin 27 receptor, alpha subunit and glycoprotein 130. WSX-1/IL-27R, a class I cytokine receptor that is homologous to the β2 chain of the IL-12R in both sequence and structure, is highly expressed by resting/naive CD4+ T cells and CD8+ T cells. WSX-1/IL-27R belongs to the IL-6/IL-12 family of cytokines and induced proliferation of naive CD4(+) T cells and the generation of a Th1-type adaptive immune response. WSX-1/IL-27R functions as a receptor for IL27. IL-27 not only contributes to the development of an adaptive immune response through its action on CD4(+) T cells, it also directly acts on cells of the innate immune system. WSX-1/IL-27R requires IL6ST/gp130 to mediate signal transduction in response to IL27. This signaling system acts through STAT3 and STAT1. It is involved in the regulation of Th1-type immune responses. IL-27R also appears to be involved in innate defense mechanisms. IL27RA is essential for transcriptional activation of STAT1 and for augmenting the induction of T-bet expression during initiation of Th1 cell differentiation.

References
  • Pflanz S, et al.. (2004) WSX-1 and glycoprotein 130 constitute a signal-transducing receptor for IL-27. J Immunol. 172(4): 2225-31.
  • Yoshida H, et al.. (2001) WSX-1 is required for the initiation of Th1 responses and resistance to L. major infection. Immunity. 215(4): 569-78.
  • Villarino A, et al.. (2003) The IL-27R (WSX-1) is required to suppress T cell hyperactivity during infection. Immunity. 19(5): 645-55.
  • Size / Price
    Catalog: CG90129-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"