IL17RA cDNA ORF Clone, Cynomolgus, C-Myc tag

Cat: CG90127-CM

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL17RA Reagents
CRO Services

All IL17RA Reagents
IL17RA cDNA ORF Clone, Cynomolgus, C-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
2598 bp
Description
Full length Clone DNA of Rhesus interleukin 17 receptor A with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL17RA Background Information

Interleukin-17 receptor (IL-17R), also known as Interleukin-17 receptor A (IL-17RA) and CD217 antigen (CD217), is a cytokine receptor which binds interleukin 17. IL-17R/IL-17RA (CD217) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. IL-17R/IL-17RA (CD217) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor IL-17RA play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Defects in IL-17R/IL-17RA (CD217) are the cause of familial candidiasis type 5 (CANDF5). CANDF5 is a rare disorder with altered immune responses and impaired clearance of fungal infections, selective against Candida. It is characterized by persistent and/or recurrent infections of the skin, nails and mucous membranes caused by organisms of the genus Candida, mainly Candida albicans.

Full Name
interleukin 17 receptor A
References
  • Gaffen SL. (2009) Structure and signalling in the IL-17 receptor family. Nat Rev Immunol. 9 (8): 556-67.
  • Johansen C, et al.. (2009) Characterization of the interleukin-17 isoforms and receptors in lesional psoriatic skin. Br J Dermatol. 160 (2): 319-24.
  • Yao Z, et al.. (1997) Molecular characterization of the human interleukin (IL)-17 receptor. Cytokine 9 (11): 794-800.
  • IL17RA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL17RA cDNA ORF Clone in Cloning Vector, Rat RG80190-G
    IL17RA cDNA ORF Clone, Rat, untagged RG80190-UT
    IL17RA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80190-ACG
    IL17RA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80190-ACGLN
    IL17RA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80190-ACR
    IL17RA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80190-CF
    IL17RA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80190-NF
    IL17RA cDNA ORF Clone, Rat, C-His tag RG80190-CH
    IL17RA cDNA ORF Clone, Rat, N-His tag RG80190-NH
    IL17RA cDNA ORF Clone, Rat, C-HA tag RG80190-CY
    IL17RA cDNA ORF Clone, Rat, N-HA tag RG80190-NY
    IL17RA cDNA ORF Clone, Rat, C-Myc tag RG80190-CM
    IL17RA cDNA ORF Clone, Rat, N-Myc tag RG80190-NM
    IL17RA qPCR Primer Pairs, Rat RP300182

    IL17RA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL17RA cDNA ORF Clone in Cloning Vector, Mouse MG50328-M
    IL17RA cDNA ORF Clone, Mouse, untagged MG50328-UT
    IL17RA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50328-ACGLN
    IL17RA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50328-ACG
    IL17RA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50328-ACR
    IL17RA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50328-CF
    IL17RA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50328-NF
    IL17RA cDNA ORF Clone, Mouse, C-His tag MG50328-CH
    IL17RA cDNA ORF Clone, Mouse, N-His tag MG50328-NH
    IL17RA cDNA ORF Clone, Mouse, C-HA tag MG50328-CY
    IL17RA cDNA ORF Clone, Mouse, N-HA tag MG50328-NY
    IL17RA cDNA ORF Clone, Mouse, C-Myc tag MG50328-CM
    IL17RA cDNA ORF Clone, Mouse, N-Myc tag MG50328-NM
    IL17RA qPCR Primer Pairs, Mouse MP200351

    IL17RA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL17RA cDNA ORF Clone in Cloning Vector, Human HG10895-G
    IL17RA cDNA ORF Clone, Human, untagged HG10895-UT
    IL17RA cDNA ORF Clone, Human, C-GFPSpark® tag HG10895-ACG
    IL17RA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10895-ACGLN
    IL17RA cDNA ORF Clone, Human, C-OFPSpark® tag HG10895-ACR
    IL17RA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10895-CF
    IL17RA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10895-NF
    IL17RA cDNA ORF Clone, Human, C-His tag HG10895-CH
    IL17RA cDNA ORF Clone, Human, N-His tag HG10895-NH
    IL17RA cDNA ORF Clone, Human, C-HA tag HG10895-CY
    IL17RA cDNA ORF Clone, Human, N-HA tag HG10895-NY
    IL17RA cDNA ORF Clone, Human, C-Myc tag HG10895-CM
    IL17RA cDNA ORF Clone, Human, N-Myc tag HG10895-NM
    IL17RA qPCR Primer Pairs, Human HP100780
    info info
    添加购物车成功! 添加购物车失败!