Quick Order

Text Size:AAA

Rhesus IL11RA/IL-11RA Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus IL11RA cDNA Clone Product Information
NCBI RefSeq:XM_001093448.2
RefSeq ORF Size:2328bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interleukin 11 receptor, alpha with N terminal Myc tag.
Gene Synonym:IL11RA
Species:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Interleukin 11 receptor, alpha subunit (IL11RA/IL-11RA) is a subunit of the interleukin 11 receptor which is a member of the hematopoietic cytokine receptor family. IL11RA/IL-11RA is expressed in a number of cell lines, including the myelogenous leukemia cell line K562, the megakaryocytic leukemia cell line Mo7E, the erythroleukemia cell line TF1, and the osteosarcoma cell lines, MG-63 and Saos-2. It is also expressed in normal and malignant prostate epithelial cell lines. Expression levels are increased in prostate carcinoma. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Alternative splicing has been observed at this locus, and three variants encoding two different isoforms have been identified. IL11RA/IL-11RA is a receptor for interleukin-11. The receptor systems for IL6, LIF, OSM, CNTF, IL11 and CT1 can utilize IL6ST for initiating signal transmission. Defects in IL11RA/IL-11RA are a cause of craniosynostosis and dental anomalies (CRSDA). CRSDA is a disorder characterized by craniosynostosis, maxillary hypoplasia, and dental anomalies, including malocclusion, delayed and ectopic tooth eruption, and/or supernumerary teeth. Some patients also display minor digit anomalies, such as syndactyly and/or clinodactyly.

References
  • Van Leuven F, et al. (1996) Molecular cloning and characterization of the human interleukin-11 receptor alpha-chain gene, IL11RA, located on chromosome 9p13. Genomics. 31 (1): 65-70.
  • Yoshizaki A, et al. (2006) Expression of interleukin (IL)-11 and IL-11 receptor in human colorectal adenocarcinoma: IL-11 up-regulation of the invasive and proliferative activity of human colorectal carcinoma cells. Int J Oncol. 29 (4): 869-76.
  • Karube K, et al. (2006) Gene expression profile of cytokines and chemokines in microdissected primary Hodgkin and Reed-Sternberg (HRS) cells: high expression of interleukin-11 receptor alpha. Ann Oncol. 17 (1): 110-6.
  • Size / Price
    Catalog: CG90126-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"