IGFBP4 cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90080-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IGFBP4 Reagents
CRO Services
Product recommended

All IGFBP4 Reagents
IGFBP4 cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
777 bp
Description
Full length Clone DNA of Rhesus insulin-like growth factor binding protein 4 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGFBP4 Background Information

Insulin-like growth factor binding protein 4 (IGFBP-4) is a 24-kDa protein that binds insulin-like growth factor 1 (IGF-1) and IGF-2 with high affinity and inhibits IGF action in vitro. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGF-binding protein-4 (IGFBP-4) inhibits IGF-I action in vitro and is the most abundant IGFBP in the rodent arterial wall. Expression of IGFBP-4 mRNA in nontransgenic littermates was maximal in liver and kidney. IGFBP-4 is a functional antagonist of IGF-I action on SMC. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.

Full Name
insulin-like growth factor binding protein 4
References
  • Wang J, et al. (1998) Overexpression of insulin-like growth factor-binding protein-4 (IGFBP-4) in smooth muscle cells of transgenic mice through a smooth muscle alpha-actin-IGFBP-4 fusion gene induces smooth muscle hypoplasia. Endocrinology. 139(5): 2605-14.
  • Chernausek SD, et al. (1995) Proteolytic cleavage of insulin-like growth factor binding protein 4 (IGFBP-4). Localization of cleavage site to non-homologous region of native IGFBP-4. J Biol Chem. 1995 May 12;270(19):11377-82.
  • IGFBP4 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IGFBP4 cDNA ORF Clone in Cloning Vector, Rhesus CG90080-G
    IGFBP4 cDNA ORF Clone, Rhesus, untagged CG90080-UT
    IGFBP4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90080-ACG
    IGFBP4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90080-ACGLN
    IGFBP4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90080-ACR
    IGFBP4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90080-CF
    IGFBP4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90080-NF
    IGFBP4 cDNA ORF Clone, Rhesus, C-His tag CG90080-CH
    IGFBP4 cDNA ORF Clone, Rhesus, N-His tag CG90080-NH
    IGFBP4 cDNA ORF Clone, Rhesus, C-HA tag CG90080-CY
    IGFBP4 cDNA ORF Clone, Rhesus, N-HA tag CG90080-NY
    IGFBP4 cDNA ORF Clone, Rhesus, N-Myc tag CG90080-NM

    IGFBP4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IGFBP4 cDNA ORF Clone in Cloning Vector, Mouse MG50250-M
    IGFBP4 cDNA ORF Clone, Mouse, untagged MG50250-UT
    IGFBP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50250-ACG
    IGFBP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50250-ACGLN
    IGFBP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50250-ACR
    IGFBP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50250-CF
    IGFBP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50250-NF
    IGFBP4 cDNA ORF Clone, Mouse, C-His tag MG50250-CH
    IGFBP4 cDNA ORF Clone, Mouse, N-His tag MG50250-NH
    IGFBP4 cDNA ORF Clone, Mouse, C-HA tag MG50250-CY
    IGFBP4 cDNA ORF Clone, Mouse, N-HA tag MG50250-NY
    IGFBP4 cDNA ORF Clone, Mouse, C-Myc tag MG50250-CM
    IGFBP4 cDNA ORF Clone, Mouse, N-Myc tag MG50250-NM
    IGFBP4 qPCR Primer Pairs, Mouse MP200276

    IGFBP4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IGFBP4 cDNA ORF Clone in Cloning Vector, Human HG10967-M
    IGFBP4 cDNA ORF Clone, Human, untagged HG10967-UT
    IGFBP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10967-ACG
    IGFBP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10967-ACGLN
    IGFBP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10967-ACR
    IGFBP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10967-CF
    IGFBP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10967-NF
    IGFBP4 cDNA ORF Clone, Human, C-His tag HG10967-CH
    IGFBP4 cDNA ORF Clone, Human, N-His tag HG10967-NH
    IGFBP4 cDNA ORF Clone, Human, C-HA tag HG10967-CY
    IGFBP4 cDNA ORF Clone, Human, N-HA tag HG10967-NY
    IGFBP4 cDNA ORF Clone, Human, C-Myc tag HG10967-CM
    IGFBP4 cDNA ORF Clone, Human, N-Myc tag HG10967-NM
    IGFBP4 qPCR Primer Pairs, Human HP100842
    info info
    添加购物车成功! 添加购物车失败!