IGFBP1 cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90085-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IGFBP1 Reagents
CRO Services
Product recommended

All IGFBP1 Reagents
IGFBP1 cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
846 bp
Description
Full length Clone DNA of Rhesus insulin-like growth factor binding protein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGFBP1 Background Information

IGFBP1, also known as IGFBP-1 and insulin-like growth factor-binding protein 1, is a member of the insulin-like growth factor binding protein family. IGF binding proteins (IGFBPs) are proteins of 24 to 45 kDa. All six IGFBPs share 50% homology with each other and have binding affinities for IGF-I and IGF-II at the same order of magnitude as the ligands have for the IGF-IR. IGF-binding proteins prolong the half-life of the IGFs and have been shown to either inhibit or stimulate the growth promoting effects of the IGFs on cell culture. They alter the interaction of IGFs with their cell surface receptors. IGFBP1 has an IGFBP domain and a thyroglobulin type-I domain. It binds both insulin-like growth factors (IGFs) I and II and circulates in the plasma. Binding of this protein prolongs the half-life of the IGFs and alters their interaction with cell surface receptors.

Full Name
insulin-like growth factor binding protein 1
References
  • Wood AW, et al. (2005) Insulin-like growth factor signaling in fish. Int Rev Cytol. 243:215-85.
  • Firth SM, et al. (2003) Cellular actions of the insulin-like growth factor binding proteins. Endocr Rev. 23 (6):824-54.
  • Ferry RJ, et al. (1999) Insulin-like growth factor binding proteins: new proteins, new functions. Horm Res. 51(2):53-67.
  • IGFBP1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IGFBP1 cDNA ORF Clone in Cloning Vector, Rhesus CG90085-G
    IGFBP1 cDNA ORF Clone, Rhesus, untagged CG90085-UT
    IGFBP1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90085-ACG
    IGFBP1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90085-ACGLN
    IGFBP1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90085-ACR
    IGFBP1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90085-CF
    IGFBP1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90085-NF
    IGFBP1 cDNA ORF Clone, Rhesus, C-His tag CG90085-CH
    IGFBP1 cDNA ORF Clone, Rhesus, N-His tag CG90085-NH
    IGFBP1 cDNA ORF Clone, Rhesus, C-HA tag CG90085-CY
    IGFBP1 cDNA ORF Clone, Rhesus, N-HA tag CG90085-NY
    IGFBP1 cDNA ORF Clone, Rhesus, N-Myc tag CG90085-NM

    IGFBP1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IGFBP1 cDNA ORF Clone in Cloning Vector, Rat RG82459-U
    IGFBP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82459-ACGLN

    IGFBP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IGFBP1 cDNA ORF Clone in Cloning Vector, Mouse MG50041-M
    IGFBP1 cDNA ORF Clone, Mouse, untagged MG50041-UT
    IGFBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50041-ACGLN
    IGFBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50041-ACG
    IGFBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50041-ACR
    IGFBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50041-CF
    IGFBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50041-NF
    IGFBP1 cDNA ORF Clone, Mouse, C-His tag MG50041-CH
    IGFBP1 cDNA ORF Clone, Mouse, N-His tag MG50041-NH
    IGFBP1 cDNA ORF Clone, Mouse, C-HA tag MG50041-CY
    IGFBP1 cDNA ORF Clone, Mouse, N-HA tag MG50041-NY
    IGFBP1 cDNA ORF Clone, Mouse, C-Myc tag MG50041-CM
    IGFBP1 cDNA ORF Clone, Mouse, N-Myc tag MG50041-NM
    IGFBP1 qPCR Primer Pairs, Mouse MP200041

    IGFBP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IGFBP1 cDNA ORF Clone in Cloning Vector, Human HG16132-G
    IGFBP1 cDNA ORF Clone, Human, untagged HG16132-UT
    IGFBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16132-ACGLN
    IGFBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16132-ACG
    IGFBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16132-ACR
    IGFBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16132-CF
    IGFBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16132-NF
    IGFBP1 cDNA ORF Clone, Human, C-His tag HG16132-CH
    IGFBP1 cDNA ORF Clone, Human, N-His tag HG16132-NH
    IGFBP1 cDNA ORF Clone, Human, C-HA tag HG16132-CY
    IGFBP1 cDNA ORF Clone, Human, N-HA tag HG16132-NY
    IGFBP1 cDNA ORF Clone, Human, C-Myc tag HG16132-CM
    IGFBP1 cDNA ORF Clone, Human, N-Myc tag HG16132-NM
    info info
    添加购物车成功! 添加购物车失败!