Quick Order

Text Size:AAA

Rhesus IFNAR2/IFNABR Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus IFNAR2 cDNA Clone Product Information
NCBI RefSeq:XM_001092342.2
RefSeq ORF Size:1551bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interferon (alpha, beta and omega) receptor 2 with N terminal His tag.
Gene Synonym:IFNAR2
Species:Rhesus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Interferon-alpha/beta receptor beta chain (IFNAR2) is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Initial cell-surface IFNAR2 expression at diagnosis assessed by flow cytometry widely distributed but showed overall significantly higher expression in CML patients when compared with normal controls. In 15 fresh patients who subsequently received IFNα therapy, IFNAR2 expression at diagnosis was significantly higher in cytogenetic good responders than in poor responders. Down-regulation of IFNAR2 expression during IFNα therapy was observed only in good responders but not in poor responders. The encoded protein also functions as an antiviral factor. IFNAR2 may associate with IFNAR1 to form the type I interferon receptor. This protein serves as a receptor for interferons alpha and beta. IFNAR2 is also involved in IFN-mediated STAT1, STAT2 and STAT3 activation. Isoform 1 and isoform 2 are directly involved in signal transduction due to their association with the TYR kinase, JAK1. Isoform 3 is a potent inhibitor of type I IFN receptor activity. Following binding of IFNα2, IFNAR2 is internalized, but, instead of being routed towards degradation as it is when complexed to IFNβ, it recycles back to the cell surface.

References
  • Ito K, et al. (2004) Initial expression of interferon alpha receptor 2 (IFNAR2) on CD34-positive cells and its down-regulation correlate with clinical response to interferon therapy in chronic myelogenous leukemia. Eur J Haematol. 73(3): 191-205.
  • Kim SH, et al. (1997) Mammalian type I interferon receptors consists of two subunits: IFNaR1 and IFNaR2. Gene. 196(1-2): 279-86.
  • Saleh AZ, et al. (2004) Regulated proteolysis of the IFNaR2 subunit of the interferon-alpha receptor. Oncogene. 23(42): 7076-86.
  • Size / Price
    Catalog: CG90112-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"