Quick Order

Rhesus Interferon alpha-B / IFNA8 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Cynomolgus IFNA8 cDNA Clone Product Information
    NCBI RefSeq:XM_001107458.2
    RefSeq ORF Size:570bp
    cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interferon, alpha 8 with N terminal Myc tag.
    Gene Synonym:IFNA8
    Species:Rhesus
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Interferon alpha-B, also known as IFNA8, belongs to the alpha/beta interferon family. Interferons are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumorcells. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They also allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. Interferons also activate immune cells, such as natural killer cells and macrophages. They increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes. They also increase the ability of uninfected host cells to resist new infection by virus. Certain symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Produced by macrophages, IFN-alpha have antiviral activities.

    References
  • Henco K. et al., 1985, J Mol Biol. 185 (2): 227-60.
  • Goeddel DV. et al., 1981, Nature. 290 (5801): 20-6.
  • Yelverton E. et al., 1981, Nucleic Acids Res. 9 (3): 731-41.
  • Kempaiah P. et al., 2012, Hum Genet. 131 (8): 1375-91.
  • Size / Price
    Catalog: CG90106-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"