IFN-alpha 13 cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90108-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IFN-alpha 13 Reagents
CRO Services
Product recommended

All IFN-alpha 13 Reagents
IFN-alpha 13 cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
573 bp
Description
Full length Clone DNA of Rhesus interferon, alpha 13 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IFN-alpha 13 cDNA ORF Clone, Rhesus, C-Myc tag Alternative Names
IFNA13 cDNA ORF Clone, Rhesus
IFN-alpha 13 Background Information
Full Name
interferon, alpha 13
References
  • Mahmutovic S, et al.. (2004) Significance of the interferon (IFN) in the therapy. Bosn J Basic Med Sci. 4(4): 42-4.
  • Wang, et al.. (2004) Fever of recombinant human interferon-alpha is mediated by opioid domain interaction with opioid receptor inducing prostaglandin E2. J Neuroimmunol. 156(1-2): 107-12.
  • IFN-alpha 13 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IFN-alpha 13 cDNA ORF Clone in Cloning Vector, Rhesus CG90108-G
    IFN-alpha 13 cDNA ORF Clone, Rhesus, untagged CG90108-UT
    IFN-alpha 13 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90108-ACGLN
    IFN-alpha 13 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90108-ACG
    IFN-alpha 13 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90108-ACR
    IFN-alpha 13 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90108-CF
    IFN-alpha 13 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90108-NF
    IFN-alpha 13 cDNA ORF Clone, Rhesus, C-His tag CG90108-CH
    IFN-alpha 13 cDNA ORF Clone, Rhesus, N-His tag CG90108-NH
    IFN-alpha 13 cDNA ORF Clone, Rhesus, C-HA tag CG90108-CY
    IFN-alpha 13 cDNA ORF Clone, Rhesus, N-HA tag CG90108-NY
    IFN-alpha 13 cDNA ORF Clone, Rhesus, N-Myc tag CG90108-NM

    IFN-alpha 13 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IFN-alpha 13 cDNA ORF Clone in Cloning Vector, Mouse MG50670-M
    IFN-alpha 13 cDNA ORF Clone, Mouse, untagged MG50670-UT
    IFN-alpha 13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50670-ACGLN
    IFN-alpha 13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50670-ACG
    IFN-alpha 13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50670-ACR
    IFN-alpha 13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50670-CF
    IFN-alpha 13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50670-NF
    IFN-alpha 13 cDNA ORF Clone, Mouse, C-His tag MG50670-CH
    IFN-alpha 13 cDNA ORF Clone, Mouse, N-His tag MG50670-NH
    IFN-alpha 13 cDNA ORF Clone, Mouse, C-HA tag MG50670-CY
    IFN-alpha 13 cDNA ORF Clone, Mouse, N-HA tag MG50670-NY
    IFN-alpha 13 cDNA ORF Clone, Mouse, C-Myc tag MG50670-CM
    IFN-alpha 13 cDNA ORF Clone, Mouse, N-Myc tag MG50670-NM
    IFN-alpha 13 qPCR Primer Pairs, Mouse MP200649

    IFN-alpha 13 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IFN-alpha 13 cDNA ORF Clone, Human, untagged HG19528-UT
    info info
    添加购物车成功! 添加购物车失败!