Quick Order

Text Size:AAA

Rhesus IFNA13 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus IFNA13 cDNA Clone Product Information
NCBI RefSeq:NM_001194367.1
RefSeq ORF Size:573bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) interferon, alpha 13 with N terminal His tag.
Gene Synonym:IFNA13
Species:Rhesus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Mahmutovic S, et al.. (2004) Significance of the interferon (IFN) in the therapy. Bosn J Basic Med Sci. 4(4): 42-4.
  • Wang, et al.. (2004) Fever of recombinant human interferon-alpha is mediated by opioid domain interaction with opioid receptor inducing prostaglandin E2. J Neuroimmunol. 156(1-2): 107-12.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"