HPD/4 HPPD cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90503-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All HPD/4 HPPD Reagents
CRO Services
Product recommended

All HPD/4 HPPD Reagents
HPD/4 HPPD cDNA ORF Clone, Rhesus, C-HA tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1182 bp
Description
Full length Clone DNA of Rhesus 4-hydroxyphenylpyruvate dioxygenase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HPD/4 HPPD Background Information
Full Name
4-hydroxyphenylpyruvate dioxygenase

HPD/4 HPPD cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
HPD/4 HPPD cDNA ORF Clone in Cloning Vector, Rhesus CG90503-U
HPD/4 HPPD cDNA ORF Clone, Rhesus, untagged CG90503-UT
HPD/4 HPPD Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90503-ACGLN
HPD/4 HPPD cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90503-ACG
HPD/4 HPPD cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90503-ANG
HPD/4 HPPD cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90503-ACR
HPD/4 HPPD cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90503-ANR
HPD/4 HPPD cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90503-CF
HPD/4 HPPD cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90503-NF
HPD/4 HPPD cDNA ORF Clone, Rhesus, C-His tag CG90503-CH
HPD/4 HPPD cDNA ORF Clone, Rhesus, N-His tag CG90503-NH
HPD/4 HPPD cDNA ORF Clone, Rhesus, N-HA tag CG90503-NY
HPD/4 HPPD cDNA ORF Clone, Rhesus, C-Myc tag CG90503-CM
HPD/4 HPPD cDNA ORF Clone, Rhesus, N-Myc tag CG90503-NM

HPD/4 HPPD cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HPD/4 HPPD cDNA ORF Clone in Cloning Vector, Rat RG81426-G

HPD/4 HPPD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HPD/4 HPPD cDNA ORF Clone in Cloning Vector, Mouse MG53537-G
HPD/4 HPPD cDNA ORF Clone, Mouse, untagged MG53537-UT
HPD/4 HPPD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53537-ACGLN
HPD/4 HPPD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53537-ACG
HPD/4 HPPD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53537-ANG
HPD/4 HPPD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53537-ACR
HPD/4 HPPD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53537-ANR
HPD/4 HPPD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53537-CF
HPD/4 HPPD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53537-NF
HPD/4 HPPD cDNA ORF Clone, Mouse, C-His tag MG53537-CH
HPD/4 HPPD cDNA ORF Clone, Mouse, N-His tag MG53537-NH
HPD/4 HPPD cDNA ORF Clone, Mouse, C-HA tag MG53537-CY
HPD/4 HPPD cDNA ORF Clone, Mouse, N-HA tag MG53537-NY
HPD/4 HPPD cDNA ORF Clone, Mouse, C-Myc tag MG53537-CM
HPD/4 HPPD cDNA ORF Clone, Mouse, N-Myc tag MG53537-NM

HPD/4 HPPD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HPD/4 HPPD cDNA ORF Clone, Human, untagged HG18025-UT
info info
添加购物车成功! 添加购物车失败!