GSTM5 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag

Cat: CG90567-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GSTM5 Reagents
CRO Services
Product recommended

All GSTM5 Reagents
GSTM5 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Cynomolgus glutathione S-transferase M5 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSTM5 Background Information
Full Name
glutathione S-transferase mu 5

GSTM5 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
GSTM5 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90567-G
GSTM5 cDNA ORF Clone, Cynomolgus, untagged CG90567-UT
GSTM5 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90567-ACGLN
GSTM5 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90567-ACG
GSTM5 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90567-ANG
GSTM5 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90567-ACR
GSTM5 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90567-ANR
GSTM5 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90567-CF
GSTM5 cDNA ORF Clone, Cynomolgus, C-His tag CG90567-CH
GSTM5 cDNA ORF Clone, Cynomolgus, N-His tag CG90567-NH
GSTM5 cDNA ORF Clone, Cynomolgus, C-HA tag CG90567-CY
GSTM5 cDNA ORF Clone, Cynomolgus, N-HA tag CG90567-NY
GSTM5 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90567-CM
GSTM5 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90567-NM

GSTM5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GSTM5 cDNA ORF Clone in Cloning Vector, Mouse MG5A1389-U
GSTM5 cDNA ORF Clone, Mouse, untagged MG5A1389-UT
GSTM5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1389-ACG
GSTM5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1389-ACGLN
GSTM5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A1389-ANG
GSTM5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1389-ACR
GSTM5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A1389-ANR
GSTM5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1389-CF
GSTM5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1389-NF
GSTM5 cDNA ORF Clone, Mouse, C-His tag MG5A1389-CH
GSTM5 cDNA ORF Clone, Mouse, N-His tag MG5A1389-NH
GSTM5 cDNA ORF Clone, Mouse, C-HA tag MG5A1389-CY
GSTM5 cDNA ORF Clone, Mouse, N-HA tag MG5A1389-NY
GSTM5 cDNA ORF Clone, Mouse, C-Myc tag MG5A1389-CM
GSTM5 cDNA ORF Clone, Mouse, N-Myc tag MG5A1389-NM

GSTM5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GSTM5 cDNA ORF Clone in Cloning Vector, Human HG15453-G
GSTM5 cDNA ORF Clone, Human, untagged HG15453-UT
GSTM5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15453-ACGLN
GSTM5 cDNA ORF Clone, Human, C-GFPSpark® tag HG15453-ACG
GSTM5 cDNA ORF Clone, Human, N-GFPSpark® tag HG15453-ANG
GSTM5 cDNA ORF Clone, Human, C-OFPSpark® tag HG15453-ACR
GSTM5 cDNA ORF Clone, Human, N-OFPSpark® tag HG15453-ANR
GSTM5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15453-CF
GSTM5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15453-NF
GSTM5 cDNA ORF Clone, Human, C-His tag HG15453-CH
GSTM5 cDNA ORF Clone, Human, N-His tag HG15453-NH
GSTM5 cDNA ORF Clone, Human, C-HA tag HG15453-CY
GSTM5 cDNA ORF Clone, Human, N-HA tag HG15453-NY
GSTM5 cDNA ORF Clone, Human, C-Myc tag HG15453-CM
GSTM5 cDNA ORF Clone, Human, N-Myc tag HG15453-NM
GSTM5 qPCR Primer Pairs, Human HP104077
info info
添加购物车成功! 添加购物车失败!