GPX-3 cDNA ORF Clone, Cynomolgus, C-HA tag

Cat: CG90502-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All GPX-3 Reagents
CRO Services
Product recommended

All GPX-3 Reagents
GPX-3 cDNA ORF Clone, Cynomolgus, C-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
681 bp
Description
Full length Clone DNA of Cynomolgus glutathione peroxidase 3 (plasma) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPX-3 Background Information
Full Name
glutathione peroxidase 3

GPX-3 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
GPX-3 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90502-U
GPX-3 cDNA ORF Clone, Cynomolgus, untagged CG90502-UT
GPX-3 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90502-ACGLN
GPX-3 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90502-ACG
GPX-3 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90502-ACR
GPX-3 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90502-CF
GPX-3 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90502-NF
GPX-3 cDNA ORF Clone, Cynomolgus, C-His tag CG90502-CH
GPX-3 cDNA ORF Clone, Cynomolgus, N-His tag CG90502-NH
GPX-3 cDNA ORF Clone, Cynomolgus, N-HA tag CG90502-NY
GPX-3 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90502-CM
GPX-3 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90502-NM

GPX-3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GPX-3 cDNA ORF Clone in Cloning Vector, Rat RG80906-U
GPX-3 cDNA ORF Clone, Rat, untagged RG80906-UT
GPX-3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80906-ACGLN
GPX-3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80906-ACG
GPX-3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80906-ACR
GPX-3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80906-CF
GPX-3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80906-NF
GPX-3 cDNA ORF Clone, Rat, C-His tag RG80906-CH
GPX-3 cDNA ORF Clone, Rat, N-His tag RG80906-NH
GPX-3 cDNA ORF Clone, Rat, C-HA tag RG80906-CY
GPX-3 cDNA ORF Clone, Rat, N-HA tag RG80906-NY
GPX-3 cDNA ORF Clone, Rat, C-Myc tag RG80906-CM
GPX-3 cDNA ORF Clone, Rat, N-Myc tag RG80906-NM
GPX-3 qPCR Primer Pairs, Rat RP300870

GPX-3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GPX-3 cDNA ORF Clone in Cloning Vector, Mouse MG50244-M
GPX-3 cDNA ORF Clone, Mouse, untagged MG50244-UT
GPX-3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50244-ACGLN
GPX-3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50244-ACG
GPX-3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50244-ACR
GPX-3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50244-CF
GPX-3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50244-NF
GPX-3 cDNA ORF Clone, Mouse, C-His tag MG50244-CH
GPX-3 cDNA ORF Clone, Mouse, N-His tag MG50244-NH
GPX-3 cDNA ORF Clone, Mouse, C-HA tag MG50244-CY
GPX-3 cDNA ORF Clone, Mouse, N-HA tag MG50244-NY
GPX-3 cDNA ORF Clone, Mouse, C-Myc tag MG50244-CM
GPX-3 cDNA ORF Clone, Mouse, N-Myc tag MG50244-NM
GPX-3 qPCR Primer Pairs, Mouse MP200270

GPX-3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GPX-3 cDNA ORF Clone in Cloning Vector, Human HG10940-M
GPX-3 cDNA ORF Clone, Human, untagged HG10940-UT
GPX-3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10940-ACGLN
GPX-3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10940-ACG
GPX-3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10940-ACR
GPX-3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10940-CF
GPX-3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10940-NF
GPX-3 cDNA ORF Clone, Human, C-His tag HG10940-CH
GPX-3 cDNA ORF Clone, Human, N-His tag HG10940-NH
GPX-3 cDNA ORF Clone, Human, C-HA tag HG10940-CY
GPX-3 cDNA ORF Clone, Human, N-HA tag HG10940-NY
GPX-3 cDNA ORF Clone, Human, C-Myc tag HG10940-CM
GPX-3 cDNA ORF Clone, Human, N-Myc tag HG10940-NM
GPX-3 qPCR Primer Pairs, Human HP100819
info info
添加购物车成功! 添加购物车失败!