GDI1 cDNA ORF Clone, Cynomolgus, C-His tag

Cat: CG90813-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GDI1 Reagents

CRO Services

Product recommended


All GDI1 Reagents

GDI1 cDNA ORF Clone, Cynomolgus, C-His tag General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1344 bp
Description
Full length Clone DNA of Cynomolgus GDP dissociation inhibitor 1 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GDI1 Background Information

Full Name
GDP dissociation inhibitor 1

GDI1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
GDI1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90813-G
GDI1 cDNA ORF Clone, Cynomolgus, untagged CG90813-UT
GDI1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90813-ACG
GDI1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90813-ACGLN
GDI1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90813-ANG
GDI1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90813-ACR
GDI1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90813-ANR
GDI1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90813-CF
GDI1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90813-NF
GDI1 cDNA ORF Clone, Cynomolgus, N-His tag CG90813-NH
GDI1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90813-CY
GDI1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90813-NY
GDI1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90813-CM
GDI1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90813-NM

GDI1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
GDI1 cDNA ORF Clone in Cloning Vector, Rabbit TG65044-G
GDI1 cDNA ORF Clone, Rabbit, untagged TG65044-UT
GDI1 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65044-ACGLN
GDI1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65044-ACG
GDI1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65044-ANG
GDI1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65044-ACR
GDI1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65044-ANR
GDI1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65044-CF
GDI1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65044-NF
GDI1 cDNA ORF Clone, Rabbit, C-His tag TG65044-CH
GDI1 cDNA ORF Clone, Rabbit, N-His tag TG65044-NH
GDI1 cDNA ORF Clone, Rabbit, C-HA tag TG65044-CY
GDI1 cDNA ORF Clone, Rabbit, N-HA tag TG65044-NY
GDI1 cDNA ORF Clone, Rabbit, C-Myc tag TG65044-CM
GDI1 cDNA ORF Clone, Rabbit, N-Myc tag TG65044-NM

GDI1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GDI1 cDNA ORF Clone in Cloning Vector, Rat RG80976-U
GDI1 cDNA ORF Clone, Rat, untagged RG80976-UT
GDI1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80976-ACGLN
GDI1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80976-ACG
GDI1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80976-ANG
GDI1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80976-ACR
GDI1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80976-ANR
GDI1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80976-CF
GDI1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80976-NF
GDI1 cDNA ORF Clone, Rat, C-His tag RG80976-CH
GDI1 cDNA ORF Clone, Rat, N-His tag RG80976-NH
GDI1 cDNA ORF Clone, Rat, C-HA tag RG80976-CY
GDI1 cDNA ORF Clone, Rat, N-HA tag RG80976-NY
GDI1 cDNA ORF Clone, Rat, C-Myc tag RG80976-CM
GDI1 cDNA ORF Clone, Rat, N-Myc tag RG80976-NM
GDI1 qPCR Primer Pairs, Rat RP300940

GDI1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GDI1 cDNA ORF Clone in Cloning Vector, Mouse MG51208-U
GDI1 cDNA ORF Clone, Mouse, untagged MG51208-UT
GDI1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51208-ACG
GDI1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51208-ACGLN
GDI1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51208-ANG
GDI1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51208-ACR
GDI1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51208-ANR
GDI1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51208-CF
GDI1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51208-NF
GDI1 cDNA ORF Clone, Mouse, C-His tag MG51208-CH
GDI1 cDNA ORF Clone, Mouse, N-His tag MG51208-NH
GDI1 cDNA ORF Clone, Mouse, C-HA tag MG51208-CY
GDI1 cDNA ORF Clone, Mouse, N-HA tag MG51208-NY
GDI1 cDNA ORF Clone, Mouse, C-Myc tag MG51208-CM
GDI1 cDNA ORF Clone, Mouse, N-Myc tag MG51208-NM
GDI1 qPCR Primer Pairs, Mouse MP201092

GDI1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GDI1 cDNA ORF Clone in Cloning Vector, Human HG16761-U
GDI1 cDNA ORF Clone, Human, untagged HG16761-UT
GDI1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16761-ACG
GDI1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16761-ACGLN
GDI1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16761-ANG
GDI1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16761-ACR
GDI1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16761-ANR
GDI1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16761-CF
GDI1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16761-NF
GDI1 cDNA ORF Clone, Human, C-His tag HG16761-CH
GDI1 cDNA ORF Clone, Human, N-His tag HG16761-NH
GDI1 cDNA ORF Clone, Human, C-HA tag HG16761-CY
GDI1 cDNA ORF Clone, Human, N-HA tag HG16761-NY
GDI1 cDNA ORF Clone, Human, C-Myc tag HG16761-CM
GDI1 cDNA ORF Clone, Human, N-Myc tag HG16761-NM
GDI1 qPCR Primer Pairs, Human HP104837
info info
添加购物车成功! 添加购物车失败!