GDF3 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90055-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GDF3 Reagents
CRO Services
Product recommended

All GDF3 Reagents
GDF3 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1095 bp
Description
Full length Clone DNA of Rhesus growth differentiation factor 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GDF3 Background Information
Full Name
growth differentiation factor 3

GDF3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
GDF3 cDNA ORF Clone in Cloning Vector, Rhesus CG90055-G
GDF3 cDNA ORF Clone, Rhesus, untagged CG90055-UT
GDF3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90055-ACGLN
GDF3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90055-ACG
GDF3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90055-ACR
GDF3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90055-CF
GDF3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90055-NF
GDF3 cDNA ORF Clone, Rhesus, C-His tag CG90055-CH
GDF3 cDNA ORF Clone, Rhesus, N-His tag CG90055-NH
GDF3 cDNA ORF Clone, Rhesus, C-HA tag CG90055-CY
GDF3 cDNA ORF Clone, Rhesus, N-HA tag CG90055-NY
GDF3 cDNA ORF Clone, Rhesus, C-Myc tag CG90055-CM

GDF3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GDF3 cDNA ORF Clone in Cloning Vector, Human HG10492-M
GDF3 cDNA ORF Clone, Human, untagged HG10492-UT
GDF3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10492-ACGLN
GDF3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10492-ACG
GDF3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10492-ACR
GDF3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10492-CF
GDF3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10492-NF
GDF3 cDNA ORF Clone, Human, C-His tag HG10492-CH
GDF3 cDNA ORF Clone, Human, N-His tag HG10492-NH
GDF3 cDNA ORF Clone, Human, C-HA tag HG10492-CY
GDF3 cDNA ORF Clone, Human, N-HA tag HG10492-NY
GDF3 cDNA ORF Clone, Human, C-Myc tag HG10492-CM
GDF3 cDNA ORF Clone, Human, N-Myc tag HG10492-NM
GDF3 qPCR Primer Pairs, Human HP100513

GDF3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GDF3 qPCR Primer Pairs, Mouse MP200348
info info
添加购物车成功! 添加购物车失败!