After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rhesus FRZB / sFRP-3 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus FRZB cDNA Clone Product Information
NCBI RefSeq:NM_001257416.2
RefSeq ORF Size:978bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) frizzled-related protein with C terminal His tag.
Gene Synonym:FRZB
Species:Rhesus
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

FRZB also known as sFRP-3, is a secreted protein containing a domain similar to the putative Wnt-binding region of the frizzled family of transmembrane receptors. FRZB is widely expressed in adult mammalian tissues. In the Xenopus gastrula, FRZB is regulated as a typical Spemann organizer component. FRZB also functions as a competitor for the cell-surface G-protein receptor Frizzled. It is espically important in embryonic development. Defects in FRZB gene can cause female-specific osteoarthritis (OA) susceptibility. FRZB may serve an important role in determining hip shape and may modify the relationship between hip shape and OA.

Size / Price
Catalog: CG90406-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"