Quick Order

Text Size:AAA

Rhesus FGF12 / FGF-12 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus FGF12 cDNA Clone Product Information
NCBI RefSeq:NM_001194006.1
RefSeq ORF Size:732bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) fibroblast growth factor 12 with N terminal His tag.
Gene Synonym:FGF12
Species:Rhesus
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

References
  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.
  • Size / Price
    Catalog: CG90074-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"