Quick Order

Text Size:AAA

Rhesus FCN1/FCNA Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus FCN1 cDNA Clone Product Information
NCBI RefSeq:XM_001098002.2
RefSeq ORF Size:981bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) ficolin (collagen/fibrinogen domain containing) 1 with C terminal Myc tag.
Gene Synonym:FCN1
Species:Rhesus
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. The Ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. Three Ficolins have been identified in humans: L-Ficolin, H-Ficolin and M-Ficolin (also referred to as Ficolin-2, -3 and -1, respectively). They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Dysfunction or abnormal expressions of Ficolins may involved in the pathogenesis of human diseases including infectious and inflammatory diseases, autoimmune disease and clinical syndrome of preeclampsia. They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Upon recognition of the infectious agent, the Ficolins act through two distinct routes: initiate the lectin pathway of complement activation through attached serine proteases (MASPs), and a primitive opsonophagocytosis thus limiting the infection and concurrently orchestrating the subsequent adaptive clonal immune response. Ficolin-1 (FCN1) is predominantly expressed in the peripheral blood leukocytes.

References
  • Thiel S. (2007) Complement activating soluble pattern recognition molecules with collagen-like regions, mannan-binding lectin, ficolins and associated proteins. Mol Immunol. 44(16): 3875-88.
  • Zhang XL, et al. (2008) Ficolins: structure, function and associated diseases. Adv Exp Med Biol. 632: 105-15.
  • Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"