CD16 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90013-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD16 Reagents
CRO Services
Product recommended

All CD16 Reagents
CD16 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
765 bp
Description
Full length Clone DNA of Rhesus Fc gamma RIIIa with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD16 Background Information

Fc receptors bind the most common class of antibody, IgG, are called Fc gamma receptors (FcγR). FcγR is divided into three classes, Fc γ RI (CD64), Fc γ RII (CD32), and Fc γ RIII (CD16). CD16 protein is a multifunctional, low/intermediate affinity receptor, which belongs to the immunoglobulin superfamily. It is found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes and macrophages. Mouse CD16 is encoded by a single gene, while, human CD16 is expressed as two distinct forms (CD16a/FcγRIIIa and CD16b/FcγRIIIb) encoded by two different highly homologous genes in a cell type-specific manner. CD16 is involved in phagocytosis, secretion of enzymes, inflammatory mediators, antibody-dependent cellular cytotoxicity (ADCC), and clearance of immune complexes.

Full Name
Fc receptor, IgG, low affinity III
References
  • Edberg JC, et al. (2002) Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus. Arthritis Rheum. 46(8): 2132-40.
  • Li P, et al. (2002) Recombinant CD16A-Ig forms a homodimer and cross-blocks the ligand binding functions of neutrophil and monocyte Fcgamma receptors. Mol Immunol. 38(7): 527-38.
  • Li P, et al. (2007) Affinity and kinetic analysis of Fcgamma receptor IIIa (CD16a) binding to IgG ligands. J Biol Chem. 282(9): 6210-21.
  • CD16 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD16 cDNA ORF Clone in Cloning Vector, Rhesus CG90013-M
    CD16 cDNA ORF Clone, Rhesus, untagged CG90013-UT
    CD16 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90013-ACG
    CD16 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90013-ACGLN
    CD16 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90013-ACR
    CD16 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90013-CF
    CD16 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90013-NF
    CD16 cDNA ORF Clone, Rhesus, C-His tag CG90013-CH
    CD16 cDNA ORF Clone, Rhesus, N-His tag CG90013-NH
    CD16 cDNA ORF Clone, Rhesus, C-HA tag CG90013-CY
    CD16 cDNA ORF Clone, Rhesus, N-HA tag CG90013-NY
    CD16 cDNA ORF Clone, Rhesus, C-Myc tag CG90013-CM

    CD16 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD16 cDNA ORF Clone in Cloning Vector, Mouse MG50326-U
    CD16 cDNA ORF Clone, Mouse, untagged MG50326-UT
    CD16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50326-ACG
    CD16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50326-ACGLN
    CD16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50326-ACR
    CD16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50326-CF
    CD16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50326-NF
    CD16 cDNA ORF Clone, Mouse, C-His tag MG50326-CH
    CD16 cDNA ORF Clone, Mouse, N-His tag MG50326-NH
    CD16 cDNA ORF Clone, Mouse, C-HA tag MG50326-CY
    CD16 cDNA ORF Clone, Mouse, N-HA tag MG50326-NY
    CD16 cDNA ORF Clone, Mouse, C-Myc tag MG50326-CM
    CD16 cDNA ORF Clone, Mouse, N-Myc tag MG50326-NM
    CD16 qPCR Primer Pairs, Mouse MP200349
    info info
    添加购物车成功! 添加购物车失败!