fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, N-His tag

Cat: CG90717-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All fumarylacetoacetate hydrolase Reagents
CRO Services
Product recommended

All fumarylacetoacetate hydrolase Reagents
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, N-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1260 bp
Description
Full length Clone DNA of Cynomolgus fumarylacetoacetate hydrolase (fumarylacetoacetase) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

fumarylacetoacetate hydrolase Background Information
Full Name
fumarylacetoacetate hydrolase (fumarylacetoacetase)

fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
fumarylacetoacetate hydrolase cDNA ORF Clone in Cloning Vector, Cynomolgus CG90717-G
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, untagged CG90717-UT
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90717-ACG
fumarylacetoacetate hydrolase Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90717-ACGLN
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90717-ANG
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90717-ACR
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90717-ANR
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90717-CF
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90717-NF
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, C-His tag CG90717-CH
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, C-HA tag CG90717-CY
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, N-HA tag CG90717-NY
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, C-Myc tag CG90717-CM
fumarylacetoacetate hydrolase cDNA ORF Clone, Cynomolgus, N-Myc tag CG90717-NM

fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
fumarylacetoacetate hydrolase cDNA ORF Clone in Cloning Vector, Rat RG80901-U
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, untagged RG80901-UT
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, C-GFPSpark® tag RG80901-ACG
fumarylacetoacetate hydrolase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80901-ACGLN
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, N-GFPSpark® tag RG80901-ANG
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, C-OFPSpark® tag RG80901-ACR
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, N-OFPSpark® tag RG80901-ANR
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80901-CF
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80901-NF
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, C-His tag RG80901-CH
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, N-His tag RG80901-NH
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, C-HA tag RG80901-CY
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, N-HA tag RG80901-NY
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, C-Myc tag RG80901-CM
fumarylacetoacetate hydrolase cDNA ORF Clone, Rat, N-Myc tag RG80901-NM
fumarylacetoacetate hydrolase qPCR Primer Pairs, Rat RP300865

fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
fumarylacetoacetate hydrolase cDNA ORF Clone in Cloning Vector, Mouse MG53747-U
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, untagged MG53747-UT
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53747-ACG
fumarylacetoacetate hydrolase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53747-ACGLN
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53747-ANG
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53747-ACR
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53747-ANR
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53747-CF
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53747-NF
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, C-His tag MG53747-CH
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, N-His tag MG53747-NH
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, C-HA tag MG53747-CY
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, N-HA tag MG53747-NY
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, C-Myc tag MG53747-CM
fumarylacetoacetate hydrolase cDNA ORF Clone, Mouse, N-Myc tag MG53747-NM

fumarylacetoacetate hydrolase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
fumarylacetoacetate hydrolase cDNA ORF Clone in Cloning Vector, Human HG14203-G
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, untagged HG14203-UT
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, C-GFPSpark® tag HG14203-ACG
fumarylacetoacetate hydrolase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14203-ACGLN
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, N-GFPSpark® tag HG14203-ANG
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, C-OFPSpark® tag HG14203-ACR
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, N-OFPSpark® tag HG14203-ANR
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14203-CF
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14203-NF
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, C-His tag HG14203-CH
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, N-His tag HG14203-NH
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, C-HA tag HG14203-CY
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, N-HA tag HG14203-NY
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, C-Myc tag HG14203-CM
fumarylacetoacetate hydrolase cDNA ORF Clone, Human, N-Myc tag HG14203-NM
fumarylacetoacetate hydrolase qPCR Primer Pairs, Human HP102853
info info
添加购物车成功! 添加购物车失败!