EID1 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90768-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EID1 Reagents
CRO Services
Product recommended

All EID1 Reagents
EID1 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
567 bp
Description
Full length Clone DNA of Rhesus EP300 interacting inhibitor of differentiation 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EID1 Background Information
Full Name
EP300 interacting inhibitor of differentiation 1

EID1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
EID1 cDNA ORF Clone in Cloning Vector, Rhesus CG90768-G
EID1 cDNA ORF Clone, Rhesus, untagged CG90768-UT
EID1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90768-ACG
EID1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90768-ACGLN
EID1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90768-ANG
EID1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90768-ACR
EID1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90768-ANR
EID1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90768-CF
EID1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90768-NF
EID1 cDNA ORF Clone, Rhesus, C-His tag CG90768-CH
EID1 cDNA ORF Clone, Rhesus, N-His tag CG90768-NH
EID1 cDNA ORF Clone, Rhesus, C-HA tag CG90768-CY
EID1 cDNA ORF Clone, Rhesus, N-HA tag CG90768-NY
EID1 cDNA ORF Clone, Rhesus, C-Myc tag CG90768-CM

EID1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EID1 cDNA ORF Clone in Cloning Vector, Rat RG8A0592-U
EID1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0592-ACGLN

EID1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EID1 cDNA ORF Clone in Cloning Vector, Mouse MG51913-G
EID1 cDNA ORF Clone, Mouse, untagged MG51913-UT
EID1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51913-ACG
EID1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51913-ACGLN
EID1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51913-ANG
EID1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51913-ACR
EID1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51913-ANR
EID1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51913-CF
EID1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51913-NF
EID1 cDNA ORF Clone, Mouse, C-His tag MG51913-CH
EID1 cDNA ORF Clone, Mouse, N-His tag MG51913-NH
EID1 cDNA ORF Clone, Mouse, C-HA tag MG51913-CY
EID1 cDNA ORF Clone, Mouse, N-HA tag MG51913-NY
EID1 cDNA ORF Clone, Mouse, C-Myc tag MG51913-CM
EID1 cDNA ORF Clone, Mouse, N-Myc tag MG51913-NM
EID1 qPCR Primer Pairs, Mouse MP201786

EID1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EID1 cDNA ORF Clone in Cloning Vector, Human HG16218-G
EID1 cDNA ORF Clone, Human, untagged HG16218-UT
EID1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16218-ACGLN
EID1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16218-ACG
EID1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16218-ANG
EID1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16218-ACR
EID1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16218-ANR
EID1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16218-CF
EID1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16218-NF
EID1 cDNA ORF Clone, Human, C-His tag HG16218-CH
EID1 cDNA ORF Clone, Human, N-His tag HG16218-NH
EID1 cDNA ORF Clone, Human, C-HA tag HG16218-CY
EID1 cDNA ORF Clone, Human, N-HA tag HG16218-NY
EID1 cDNA ORF Clone, Human, C-Myc tag HG16218-CM
EID1 cDNA ORF Clone, Human, N-Myc tag HG16218-NM
EID1 qPCR Primer Pairs, Human HP104983
info info
添加购物车成功! 添加购物车失败!