EEF1A1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag

Cat: CG90575-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EEF1A1 Reagents
CRO Services
Product recommended

All EEF1A1 Reagents
EEF1A1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1389 bp
Description
Full length Clone DNA of Rhesus eukaryotic translation elongation factor 1 alpha 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EEF1A1 Background Information
Full Name
eukaryotic translation elongation factor 1 alpha 1

EEF1A1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
EEF1A1 cDNA ORF Clone in Cloning Vector, Rhesus CG90575-G
EEF1A1 cDNA ORF Clone, Rhesus, untagged CG90575-UT
EEF1A1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90575-ACG
EEF1A1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90575-ACGLN
EEF1A1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90575-ANG
EEF1A1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90575-ACR
EEF1A1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90575-ANR
EEF1A1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90575-CF
EEF1A1 cDNA ORF Clone, Rhesus, C-His tag CG90575-CH
EEF1A1 cDNA ORF Clone, Rhesus, N-His tag CG90575-NH
EEF1A1 cDNA ORF Clone, Rhesus, C-HA tag CG90575-CY
EEF1A1 cDNA ORF Clone, Rhesus, N-HA tag CG90575-NY
EEF1A1 cDNA ORF Clone, Rhesus, C-Myc tag CG90575-CM
EEF1A1 cDNA ORF Clone, Rhesus, N-Myc tag CG90575-NM

EEF1A1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
EEF1A1 cDNA ORF Clone in Cloning Vector, Rabbit TG65070-G
EEF1A1 cDNA ORF Clone, Rabbit, untagged TG65070-UT
EEF1A1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65070-ACG
EEF1A1 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65070-ACGLN
EEF1A1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65070-ANG
EEF1A1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65070-ACR
EEF1A1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65070-ANR
EEF1A1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65070-CF
EEF1A1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65070-NF
EEF1A1 cDNA ORF Clone, Rabbit, C-His tag TG65070-CH
EEF1A1 cDNA ORF Clone, Rabbit, N-His tag TG65070-NH
EEF1A1 cDNA ORF Clone, Rabbit, C-HA tag TG65070-CY
EEF1A1 cDNA ORF Clone, Rabbit, N-HA tag TG65070-NY
EEF1A1 cDNA ORF Clone, Rabbit, C-Myc tag TG65070-CM
EEF1A1 cDNA ORF Clone, Rabbit, N-Myc tag TG65070-NM

EEF1A1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EEF1A1 cDNA ORF Clone in Cloning Vector, Rat RG80887-U
EEF1A1 cDNA ORF Clone, Rat, untagged RG80887-UT
EEF1A1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80887-ACG
EEF1A1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80887-ACGLN
EEF1A1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80887-ANG
EEF1A1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80887-ACR
EEF1A1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80887-ANR
EEF1A1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80887-CF
EEF1A1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80887-NF
EEF1A1 cDNA ORF Clone, Rat, C-His tag RG80887-CH
EEF1A1 cDNA ORF Clone, Rat, N-His tag RG80887-NH
EEF1A1 cDNA ORF Clone, Rat, C-HA tag RG80887-CY
EEF1A1 cDNA ORF Clone, Rat, N-HA tag RG80887-NY
EEF1A1 cDNA ORF Clone, Rat, C-Myc tag RG80887-CM
EEF1A1 cDNA ORF Clone, Rat, N-Myc tag RG80887-NM
EEF1A1 qPCR Primer Pairs, Rat RP300851

EEF1A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EEF1A1 cDNA ORF Clone in Cloning Vector, Mouse MG51317-G
EEF1A1 cDNA ORF Clone, Mouse, untagged MG51317-UT
EEF1A1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51317-ACG
EEF1A1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51317-ACGLN
EEF1A1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51317-ANG
EEF1A1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51317-ACR
EEF1A1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51317-ANR
EEF1A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51317-CF
EEF1A1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51317-NF
EEF1A1 cDNA ORF Clone, Mouse, C-His tag MG51317-CH
EEF1A1 cDNA ORF Clone, Mouse, N-His tag MG51317-NH
EEF1A1 cDNA ORF Clone, Mouse, C-HA tag MG51317-CY
EEF1A1 cDNA ORF Clone, Mouse, N-HA tag MG51317-NY
EEF1A1 cDNA ORF Clone, Mouse, C-Myc tag MG51317-CM
EEF1A1 cDNA ORF Clone, Mouse, N-Myc tag MG51317-NM
EEF1A1 qPCR Primer Pairs, Mouse MP201194

EEF1A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EEF1A1 cDNA ORF Clone in Cloning Vector, Human HG14076-G
EEF1A1 cDNA ORF Clone, Human, untagged HG14076-UT
EEF1A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14076-ACGLN
EEF1A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14076-ACG
EEF1A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14076-ANG
EEF1A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14076-ACR
EEF1A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14076-ANR
EEF1A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14076-CF
EEF1A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14076-NF
EEF1A1 cDNA ORF Clone, Human, C-His tag HG14076-CH
EEF1A1 cDNA ORF Clone, Human, N-His tag HG14076-NH
EEF1A1 cDNA ORF Clone, Human, C-HA tag HG14076-CY
EEF1A1 cDNA ORF Clone, Human, N-HA tag HG14076-NY
EEF1A1 cDNA ORF Clone, Human, C-Myc tag HG14076-CM
EEF1A1 cDNA ORF Clone, Human, N-Myc tag HG14076-NM
EEF1A1 qPCR Primer Pairs, Human HP102730
info info
添加购物车成功! 添加购物车失败!