EDAR cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90111-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EDAR Reagents
CRO Services
Product recommended

All EDAR Reagents
EDAR cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1347 bp
Description
Full length Clone DNA of Rhesus ectodysplasin A receptor with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EDAR Background Information

Tumor necrosis factor receptor superfamily member EDAR is a Single-pass type I membrane protein. Edar was expressed reiteratively in signaling centers regulating key steps in morphogenesis. activin signaling from mesenchyme induces the expression of the TNF receptor edar in the epithelial signaling centers, thus making them responsive to Wnt-induced ectodysplasin from the nearby ectoderm. This is the first demonstration of integration of the Wnt, activin, and TNF signaling pathways. Defects in EDAR are a cause of ectodermal dysplasia anhidrotic (EDA), also known ectodermal dysplasia hypohidrotic autosomal recessive (HED). Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EDA is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands.

Full Name
ectodysplasin A receptor
References
  • Elomaa O, et al. (2001) Ectodysplasin is released by proteolytic shedding and binds to the EDAR protein. Hum Mol Genet. 10 (9): 953-62.
  • Koppinen P, et al. (2001) Signaling and subcellular localization of the TNF receptor Edar. Exp Cell Res. 269 (2): 180-92.
  • Chassaing N, et al. (2006) Mutations in EDAR account for one-quarter of non-ED1-related hypohidrotic ectodermal dysplasia. Hu. Mutat. 27 (3): 255-9.
  • EDAR cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    EDAR cDNA ORF Clone in Cloning Vector, Rhesus CG90111-G
    EDAR cDNA ORF Clone, Rhesus, untagged CG90111-UT
    EDAR cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90111-ACG
    EDAR Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90111-ACGLN
    EDAR cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90111-ACR
    EDAR cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90111-CF
    EDAR cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90111-NF
    EDAR cDNA ORF Clone, Rhesus, C-His tag CG90111-CH
    EDAR cDNA ORF Clone, Rhesus, N-His tag CG90111-NH
    EDAR cDNA ORF Clone, Rhesus, C-HA tag CG90111-CY
    EDAR cDNA ORF Clone, Rhesus, N-HA tag CG90111-NY
    EDAR cDNA ORF Clone, Rhesus, N-Myc tag CG90111-NM

    EDAR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    EDAR cDNA ORF Clone in Cloning Vector, Rat RG80228-G
    EDAR cDNA ORF Clone, Rat, untagged RG80228-UT
    EDAR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80228-ACGLN
    EDAR cDNA ORF Clone, Rat, C-GFPSpark® tag RG80228-ACG
    EDAR cDNA ORF Clone, Rat, C-OFPSpark® tag RG80228-ACR
    EDAR cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80228-CF
    EDAR cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80228-NF
    EDAR cDNA ORF Clone, Rat, C-His tag RG80228-CH
    EDAR cDNA ORF Clone, Rat, N-His tag RG80228-NH
    EDAR cDNA ORF Clone, Rat, C-HA tag RG80228-CY
    EDAR cDNA ORF Clone, Rat, N-HA tag RG80228-NY
    EDAR cDNA ORF Clone, Rat, C-Myc tag RG80228-CM
    EDAR cDNA ORF Clone, Rat, N-Myc tag RG80228-NM
    EDAR qPCR Primer Pairs, Rat RP300218

    EDAR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EDAR cDNA ORF Clone, Human, untagged HG11577-UT
    EDAR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11577-ACGLN
    EDAR qPCR Primer Pairs, Human HP101445
    info info
    添加购物车成功! 添加购物车失败!